Mutagenetix > Incidental Mutation

Incidental Mutation 'R6949:Rexo1'

543254

Institutional Source

Beutler Lab

Gene Symbol

Rexo1

Ensembl Gene

ENSMUSG00000047417

Gene Name

REX1, RNA exonuclease 1

Synonyms

2610511M11Rik, Tceb3bp1, 1700021P10Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.440) question?

Stock #

R6949 (G1)

Quality Score

134.008

Status

Validated

Chromosome

Chromosomal Location

80540922-80561560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80550636 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 196 (V196A)

Ref Sequence

ENSEMBL: ENSMUSP00000049705 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057910]

AlphaFold

Q7TT28

Predicted Effect

possibly damaging
Transcript: ENSMUST00000057910
AA Change: V196A

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000049705
Gene: ENSMUSG00000047417
AA Change: V196A

Domain	Start	End	E-Value	Type
low complexity region	34	53	N/A	INTRINSIC
coiled coil region	83	113	N/A	INTRINSIC
low complexity region	180	188	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
low complexity region	383	396	N/A	INTRINSIC
low complexity region	440	453	N/A	INTRINSIC
low complexity region	468	479	N/A	INTRINSIC
low complexity region	507	525	N/A	INTRINSIC
low complexity region	533	551	N/A	INTRINSIC
low complexity region	561	583	N/A	INTRINSIC
low complexity region	667	682	N/A	INTRINSIC
Pfam:EloA-BP1	794	954	3.8e-72	PFAM
EXOIII	1051	1210	2.36e-38	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182260

Predicted Effect

probably benign
Transcript: ENSMUST00000183073

Meta Mutation Damage Score

0.0785

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.8%
20x: 95.1%

Validation Efficiency

100% (45/45)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank2	G	T	3: 127,010,884	D679E	probably benign	Het
Catsper4	A	T	4: 134,225,747	Y96N	probably benign	Het
Cnksr3	T	C	10: 7,160,757	I35V	probably benign	Het
Col16a1	A	G	4: 130,059,323	E424G	probably damaging	Het
Ctsc	G	T	7: 88,281,458	G82W	probably damaging	Het
Cxcr4	T	C	1: 128,589,615	D101G	probably benign	Het
Dapk1	T	A	13: 60,736,324	N635K	probably benign	Het
Dopey1	T	C	9: 86,500,860	M282T	probably damaging	Het
Dpysl4	G	A	7: 139,091,999	E172K	probably damaging	Het
Eif2ak3	T	C	6: 70,878,845	I211T	probably damaging	Het
Fam71f1	T	A	6: 29,323,906	I210N	probably damaging	Het
Fbxw22	A	T	9: 109,382,076	W386R	probably benign	Het
Gm11639	A	C	11: 104,909,070	T2931P	probably damaging	Het
Grm7	A	G	6: 110,646,304	K146R	probably benign	Het
Grm7	C	A	6: 111,495,729	P843Q	probably damaging	Het
Gtf2e2	A	G	8: 33,758,698	D171G	probably damaging	Het
Hyal5	T	C	6: 24,876,304	S59P	probably benign	Het
Il7r	T	A	15: 9,508,004	T411S	probably damaging	Het
Kcp	T	A	6: 29,484,612		probably null	Het
Krcc1	T	C	6: 71,284,151	Y56H	probably benign	Het
Lmo2	T	A	2: 103,970,673	M1K	probably null	Het
Lrit3	G	A	3: 129,789,285	T351I	probably damaging	Het
Mcu	T	G	10: 59,456,744	T38P	possibly damaging	Het
Mylk	T	A	16: 35,000,318	I89N	probably damaging	Het
Ncoa2	A	T	1: 13,156,501	C996S	possibly damaging	Het
Npr2	A	G	4: 43,640,597	E350G	probably damaging	Het
Olfr1437	T	C	19: 12,322,428	Y133C	probably damaging	Het
Pald1	T	C	10: 61,321,217	E818G	probably benign	Het
Phf19	G	T	2: 34,904,131	Q210K	probably damaging	Het
Pomgnt1	G	A	4: 116,154,154	V250M	probably damaging	Het
Ppm1l	T	A	3: 69,549,403	C218S	possibly damaging	Het
Prkdc	G	A	16: 15,799,989	R3228H	probably benign	Het
Pros1	A	T	16: 62,924,575	T518S	probably benign	Het
Rdh8	T	A	9: 20,822,707	V63D	probably benign	Het
Scgb2b20	A	T	7: 33,366,299	M1K	probably null	Het
Scn11a	A	G	9: 119,765,514	V1271A	probably benign	Het
Serac1	C	A	17: 6,051,815	D395Y	probably damaging	Het
Syne2	A	G	12: 75,965,997	D2655G	probably benign	Het
Tm4sf19	T	C	16: 32,405,858	V8A	probably benign	Het
Usp3	A	T	9: 66,520,690	D334E	probably benign	Het
Uty	C	T	Y: 1,240,000		probably null	Het
Vmn2r7	T	C	3: 64,691,121	N672D	probably damaging	Het
Vmn2r96	T	A	17: 18,597,838	L751H	probably damaging	Het
Wnk2	T	C	13: 49,101,140	S300G	probably damaging	Het
Zp3r	G	T	1: 130,577,895	S508R	probably benign	Het

Other mutations in Rexo1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00970:Rexo1	APN	10	80550964	missense	probably damaging	0.99
IGL01128:Rexo1	APN	10	80549739	missense	probably benign
IGL01890:Rexo1	APN	10	80543011	missense	possibly damaging	0.85
PIT4453001:Rexo1	UTSW	10	80550397	missense	probably damaging	0.97
R0044:Rexo1	UTSW	10	80544378	missense	probably benign	0.16
R0365:Rexo1	UTSW	10	80542576	missense	probably damaging	0.99
R0573:Rexo1	UTSW	10	80544850	missense	probably damaging	1.00
R1146:Rexo1	UTSW	10	80544405	missense	probably benign	0.04
R1146:Rexo1	UTSW	10	80544405	missense	probably benign	0.04
R1511:Rexo1	UTSW	10	80550050	missense	possibly damaging	0.93
R1523:Rexo1	UTSW	10	80542751	missense	probably benign	0.41
R1807:Rexo1	UTSW	10	80542579	missense	possibly damaging	0.95
R1868:Rexo1	UTSW	10	80542920	missense	probably damaging	1.00
R1935:Rexo1	UTSW	10	80550469	missense	probably benign	0.00
R1936:Rexo1	UTSW	10	80550469	missense	probably benign	0.00
R1957:Rexo1	UTSW	10	80543366	missense	probably damaging	0.96
R2084:Rexo1	UTSW	10	80561266	missense	probably benign	0.01
R2153:Rexo1	UTSW	10	80544109	nonsense	probably null
R2262:Rexo1	UTSW	10	80549569	missense	probably benign	0.02
R4471:Rexo1	UTSW	10	80542658	missense	probably damaging	1.00
R4472:Rexo1	UTSW	10	80542658	missense	probably damaging	1.00
R4690:Rexo1	UTSW	10	80546421	missense	probably benign	0.01
R4972:Rexo1	UTSW	10	80549693	missense	probably damaging	0.96
R6335:Rexo1	UTSW	10	80544081	missense	probably damaging	1.00
R6505:Rexo1	UTSW	10	80543011	missense	possibly damaging	0.85
R6615:Rexo1	UTSW	10	80544014	missense	possibly damaging	0.68
R7612:Rexo1	UTSW	10	80549663	missense	probably benign	0.40
R7807:Rexo1	UTSW	10	80550136	missense	probably benign	0.09
R7840:Rexo1	UTSW	10	80550738	missense	probably benign
R8779:Rexo1	UTSW	10	80548458	missense	probably benign	0.26
R8897:Rexo1	UTSW	10	80542603	missense	probably damaging	0.98
R8995:Rexo1	UTSW	10	80550261	missense	probably damaging	0.96
R9094:Rexo1	UTSW	10	80543020	missense	probably damaging	1.00
R9411:Rexo1	UTSW	10	80561414	missense
R9438:Rexo1	UTSW	10	80543014	missense	possibly damaging	0.46
R9524:Rexo1	UTSW	10	80551038	missense	probably damaging	1.00
Z1177:Rexo1	UTSW	10	80549775	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGAGTCTGAGAACCTGGC -3'
(R):5'- CATTGGCCCTAACTTACACGCC -3'

Sequencing Primer
(F):5'- CAGGAGTGTATGGCTCAGCAC -3'
(R):5'- CCGGGTGGCCTGCTGAG -3'

Posted On

2018-11-28