Mutagenetix > Incidental Mutation

Incidental Mutation 'R6949:Pros1'

543263

Institutional Source

Beutler Lab

Gene Symbol

Pros1

Ensembl Gene

ENSMUSG00000022912

Gene Name

protein S (alpha)

Synonyms

protein S

MMRRC Submission

Accession Numbers

Genbank: NM_011173; MGI: 1095733

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6949 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62854307-62929346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62924575 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 518 (T518S)

Ref Sequence

ENSEMBL: ENSMUSP00000023629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023629]

AlphaFold

Q08761

Predicted Effect

probably benign
Transcript: ENSMUST00000023629
AA Change: T518S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: T518S

Domain	Start	End	E-Value	Type
GLA	23	86	3.63e-31	SMART
EGF	120	155	4.39e-2	SMART
EGF_CA	157	200	6.91e-9	SMART
EGF_CA	201	242	5.23e-9	SMART
EGF_CA	243	283	1.1e-7	SMART
LamG	321	458	8.55e-22	SMART
LamG	506	646	1.57e-1	SMART

Meta Mutation Damage Score

0.1194

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.8%
20x: 95.1%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank2	G	T	3: 127,010,884	D679E	probably benign	Het
Catsper4	A	T	4: 134,225,747	Y96N	probably benign	Het
Cnksr3	T	C	10: 7,160,757	I35V	probably benign	Het
Col16a1	A	G	4: 130,059,323	E424G	probably damaging	Het
Ctsc	G	T	7: 88,281,458	G82W	probably damaging	Het
Cxcr4	T	C	1: 128,589,615	D101G	probably benign	Het
Dapk1	T	A	13: 60,736,324	N635K	probably benign	Het
Dopey1	T	C	9: 86,500,860	M282T	probably damaging	Het
Dpysl4	G	A	7: 139,091,999	E172K	probably damaging	Het
Eif2ak3	T	C	6: 70,878,845	I211T	probably damaging	Het
Fam71f1	T	A	6: 29,323,906	I210N	probably damaging	Het
Fbxw22	A	T	9: 109,382,076	W386R	probably benign	Het
Gm11639	A	C	11: 104,909,070	T2931P	probably damaging	Het
Grm7	A	G	6: 110,646,304	K146R	probably benign	Het
Grm7	C	A	6: 111,495,729	P843Q	probably damaging	Het
Gtf2e2	A	G	8: 33,758,698	D171G	probably damaging	Het
Hyal5	T	C	6: 24,876,304	S59P	probably benign	Het
Il7r	T	A	15: 9,508,004	T411S	probably damaging	Het
Kcp	T	A	6: 29,484,612		probably null	Het
Krcc1	T	C	6: 71,284,151	Y56H	probably benign	Het
Lmo2	T	A	2: 103,970,673	M1K	probably null	Het
Lrit3	G	A	3: 129,789,285	T351I	probably damaging	Het
Mcu	T	G	10: 59,456,744	T38P	possibly damaging	Het
Mylk	T	A	16: 35,000,318	I89N	probably damaging	Het
Ncoa2	A	T	1: 13,156,501	C996S	possibly damaging	Het
Npr2	A	G	4: 43,640,597	E350G	probably damaging	Het
Olfr1437	T	C	19: 12,322,428	Y133C	probably damaging	Het
Pald1	T	C	10: 61,321,217	E818G	probably benign	Het
Phf19	G	T	2: 34,904,131	Q210K	probably damaging	Het
Pomgnt1	G	A	4: 116,154,154	V250M	probably damaging	Het
Ppm1l	T	A	3: 69,549,403	C218S	possibly damaging	Het
Prkdc	G	A	16: 15,799,989	R3228H	probably benign	Het
Rdh8	T	A	9: 20,822,707	V63D	probably benign	Het
Rexo1	A	G	10: 80,550,636	V196A	possibly damaging	Het
Scgb2b20	A	T	7: 33,366,299	M1K	probably null	Het
Scn11a	A	G	9: 119,765,514	V1271A	probably benign	Het
Serac1	C	A	17: 6,051,815	D395Y	probably damaging	Het
Syne2	A	G	12: 75,965,997	D2655G	probably benign	Het
Tm4sf19	T	C	16: 32,405,858	V8A	probably benign	Het
Usp3	A	T	9: 66,520,690	D334E	probably benign	Het
Uty	C	T	Y: 1,240,000		probably null	Het
Vmn2r7	T	C	3: 64,691,121	N672D	probably damaging	Het
Vmn2r96	T	A	17: 18,597,838	L751H	probably damaging	Het
Wnk2	T	C	13: 49,101,140	S300G	probably damaging	Het
Zp3r	G	T	1: 130,577,895	S508R	probably benign	Het

Other mutations in Pros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00937:Pros1	APN	16	62910045	missense	probably damaging	0.99
IGL01300:Pros1	APN	16	62913811	missense	possibly damaging	0.85
IGL02709:Pros1	APN	16	62898945	missense	probably damaging	0.99
IGL03080:Pros1	APN	16	62918143	missense	probably damaging	0.98
IGL03095:Pros1	APN	16	62907769	nonsense	probably null
F6893:Pros1	UTSW	16	62924639	missense	probably damaging	0.98
R0124:Pros1	UTSW	16	62913946	missense	possibly damaging	0.95
R0517:Pros1	UTSW	16	62903518	missense	probably benign	0.03
R1113:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1308:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1355:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1370:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1517:Pros1	UTSW	16	62885512	missense	probably damaging	0.98
R1866:Pros1	UTSW	16	62928135	missense	possibly damaging	0.86
R1876:Pros1	UTSW	16	62903518	missense	probably damaging	0.96
R2255:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R2364:Pros1	UTSW	16	62913848	missense	probably damaging	0.99
R2369:Pros1	UTSW	16	62928069	missense	probably damaging	1.00
R2979:Pros1	UTSW	16	62913866	missense	probably damaging	0.99
R3724:Pros1	UTSW	16	62900329	missense	possibly damaging	0.86
R4056:Pros1	UTSW	16	62900645	nonsense	probably null
R4556:Pros1	UTSW	16	62900673	missense	possibly damaging	0.95
R4688:Pros1	UTSW	16	62889007	critical splice donor site	probably null
R4850:Pros1	UTSW	16	62885524	missense	probably damaging	0.98
R4923:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R5008:Pros1	UTSW	16	62928185	missense	possibly damaging	0.53
R5370:Pros1	UTSW	16	62913976	missense	probably benign	0.01
R5580:Pros1	UTSW	16	62926326	critical splice acceptor site	probably null
R5930:Pros1	UTSW	16	62928061	missense	probably damaging	0.96
R5974:Pros1	UTSW	16	62900667	missense	probably damaging	0.98
R6233:Pros1	UTSW	16	62898921	missense	possibly damaging	0.47
R7055:Pros1	UTSW	16	62928102	missense	possibly damaging	0.85
R7347:Pros1	UTSW	16	62919523	missense	probably damaging	0.97
R7375:Pros1	UTSW	16	62924550	missense	probably damaging	0.96
R7419:Pros1	UTSW	16	62928070	nonsense	probably null
R7980:Pros1	UTSW	16	62928153	missense	possibly damaging	0.86
R8234:Pros1	UTSW	16	62928177	missense	possibly damaging	0.73
R8479:Pros1	UTSW	16	62907739	missense	probably damaging	1.00
R8514:Pros1	UTSW	16	62910109	missense	probably benign	0.03
R8827:Pros1	UTSW	16	62926464	missense	probably benign	0.13
R9131:Pros1	UTSW	16	62928034	missense	probably damaging	0.96
R9484:Pros1	UTSW	16	62924524	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AGGTCTGAACATTGGTGAATTTGC -3'
(R):5'- CAGACGCCAAGGTTTCTCAG -3'

Sequencing Primer
(F):5'- CTGAACATTGGTGAATTTGCTTGAG -3'
(R):5'- AGACGCCAAGGTTTCTCAGTACTC -3'

Posted On

2018-11-28