Mutagenetix > Incidental Mutation

Incidental Mutation 'R6949:Serac1'

543264

Institutional Source

Beutler Lab

Gene Symbol

Serac1

Ensembl Gene

ENSMUSG00000015659

Gene Name

serine active site containing 1

Synonyms

4930511N22Rik, D17Ertd141e

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6949 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

6042196-6079741 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 6051815 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 395 (D395Y)

Ref Sequence

ENSEMBL: ENSMUSP00000095043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024570] [ENSMUST00000097432]

AlphaFold

Q3U213

Predicted Effect

probably damaging
Transcript: ENSMUST00000024570
AA Change: D365Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000024570
Gene: ENSMUSG00000015659
AA Change: D365Y

Domain	Start	End	E-Value	Type
transmembrane domain	32	54	N/A	INTRINSIC
low complexity region	161	169	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
SCOP:d1jdha_	243	336	3e-5	SMART
Pfam:PGAP1	360	519	3.4e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000097432
AA Change: D395Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095043
Gene: ENSMUSG00000015659
AA Change: D395Y

Domain	Start	End	E-Value	Type
transmembrane domain	32	54	N/A	INTRINSIC
SCOP:d1gw5a_	89	464	3e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.8%
20x: 95.1%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphatidylglycerol remodeling protein found at the interface of mitochondria and endoplasmic reticula, where it mediates phospholipid exchange. The encoded protein plays a major role in mitochondrial function and intracellular cholesterol trafficking. Defects in this gene are a cause of 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL). Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank2	G	T	3: 127,010,884	D679E	probably benign	Het
Catsper4	A	T	4: 134,225,747	Y96N	probably benign	Het
Cnksr3	T	C	10: 7,160,757	I35V	probably benign	Het
Col16a1	A	G	4: 130,059,323	E424G	probably damaging	Het
Ctsc	G	T	7: 88,281,458	G82W	probably damaging	Het
Cxcr4	T	C	1: 128,589,615	D101G	probably benign	Het
Dapk1	T	A	13: 60,736,324	N635K	probably benign	Het
Dopey1	T	C	9: 86,500,860	M282T	probably damaging	Het
Dpysl4	G	A	7: 139,091,999	E172K	probably damaging	Het
Eif2ak3	T	C	6: 70,878,845	I211T	probably damaging	Het
Fam71f1	T	A	6: 29,323,906	I210N	probably damaging	Het
Fbxw22	A	T	9: 109,382,076	W386R	probably benign	Het
Gm11639	A	C	11: 104,909,070	T2931P	probably damaging	Het
Grm7	A	G	6: 110,646,304	K146R	probably benign	Het
Grm7	C	A	6: 111,495,729	P843Q	probably damaging	Het
Gtf2e2	A	G	8: 33,758,698	D171G	probably damaging	Het
Hyal5	T	C	6: 24,876,304	S59P	probably benign	Het
Il7r	T	A	15: 9,508,004	T411S	probably damaging	Het
Kcp	T	A	6: 29,484,612		probably null	Het
Krcc1	T	C	6: 71,284,151	Y56H	probably benign	Het
Lmo2	T	A	2: 103,970,673	M1K	probably null	Het
Lrit3	G	A	3: 129,789,285	T351I	probably damaging	Het
Mcu	T	G	10: 59,456,744	T38P	possibly damaging	Het
Mylk	T	A	16: 35,000,318	I89N	probably damaging	Het
Ncoa2	A	T	1: 13,156,501	C996S	possibly damaging	Het
Npr2	A	G	4: 43,640,597	E350G	probably damaging	Het
Olfr1437	T	C	19: 12,322,428	Y133C	probably damaging	Het
Pald1	T	C	10: 61,321,217	E818G	probably benign	Het
Phf19	G	T	2: 34,904,131	Q210K	probably damaging	Het
Pomgnt1	G	A	4: 116,154,154	V250M	probably damaging	Het
Ppm1l	T	A	3: 69,549,403	C218S	possibly damaging	Het
Prkdc	G	A	16: 15,799,989	R3228H	probably benign	Het
Pros1	A	T	16: 62,924,575	T518S	probably benign	Het
Rdh8	T	A	9: 20,822,707	V63D	probably benign	Het
Rexo1	A	G	10: 80,550,636	V196A	possibly damaging	Het
Scgb2b20	A	T	7: 33,366,299	M1K	probably null	Het
Scn11a	A	G	9: 119,765,514	V1271A	probably benign	Het
Syne2	A	G	12: 75,965,997	D2655G	probably benign	Het
Tm4sf19	T	C	16: 32,405,858	V8A	probably benign	Het
Usp3	A	T	9: 66,520,690	D334E	probably benign	Het
Uty	C	T	Y: 1,240,000		probably null	Het
Vmn2r7	T	C	3: 64,691,121	N672D	probably damaging	Het
Vmn2r96	T	A	17: 18,597,838	L751H	probably damaging	Het
Wnk2	T	C	13: 49,101,140	S300G	probably damaging	Het
Zp3r	G	T	1: 130,577,895	S508R	probably benign	Het

Other mutations in Serac1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01326:Serac1	APN	17	6074253	splice site	probably benign
IGL02642:Serac1	APN	17	6045746	missense	possibly damaging	0.56
IGL02972:Serac1	APN	17	6070764	nonsense	probably null
FR4304:Serac1	UTSW	17	6070808	missense	probably damaging	1.00
FR4340:Serac1	UTSW	17	6070808	missense	probably damaging	1.00
FR4342:Serac1	UTSW	17	6070808	missense	probably damaging	1.00
FR4589:Serac1	UTSW	17	6070808	missense	probably damaging	1.00
PIT4480001:Serac1	UTSW	17	6050812	missense	probably damaging	1.00
R0076:Serac1	UTSW	17	6064937	splice site	probably benign
R0076:Serac1	UTSW	17	6064937	splice site	probably benign
R0127:Serac1	UTSW	17	6048840	missense	probably damaging	1.00
R0211:Serac1	UTSW	17	6050060	missense	possibly damaging	0.67
R0245:Serac1	UTSW	17	6051756	missense	probably damaging	1.00
R0538:Serac1	UTSW	17	6048826	splice site	probably benign
R0652:Serac1	UTSW	17	6051756	missense	probably damaging	1.00
R0988:Serac1	UTSW	17	6061580	missense	probably benign	0.02
R1965:Serac1	UTSW	17	6048999	missense	possibly damaging	0.72
R1984:Serac1	UTSW	17	6045689	splice site	probably null
R2145:Serac1	UTSW	17	6050785	missense	probably damaging	1.00
R3426:Serac1	UTSW	17	6066778	missense	probably benign	0.04
R3921:Serac1	UTSW	17	6066792	missense	probably damaging	1.00
R4760:Serac1	UTSW	17	6051790	missense	possibly damaging	0.69
R4958:Serac1	UTSW	17	6069382	missense	probably benign	0.15
R5552:Serac1	UTSW	17	6056692	nonsense	probably null
R5874:Serac1	UTSW	17	6043913	unclassified	probably benign
R5964:Serac1	UTSW	17	6065049	missense	probably benign
R6614:Serac1	UTSW	17	6045662	missense	probably damaging	1.00
R6794:Serac1	UTSW	17	6051710	missense	probably damaging	1.00
R7157:Serac1	UTSW	17	6074201	missense	probably benign
R7161:Serac1	UTSW	17	6065076	missense	probably damaging	0.97
R7426:Serac1	UTSW	17	6069314	missense	probably damaging	1.00
R8270:Serac1	UTSW	17	6050758	missense	probably damaging	1.00
R8733:Serac1	UTSW	17	6050028	missense	probably damaging	1.00
R8785:Serac1	UTSW	17	6044202	missense	probably damaging	0.99
R9057:Serac1	UTSW	17	6061615	missense	probably damaging	0.98
R9657:Serac1	UTSW	17	6069383	missense	probably benign	0.04
Z1088:Serac1	UTSW	17	6048918	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGATGACCGCAGCAGCAAG -3'
(R):5'- GAGTCTCTCTTCACTGAAGGAAC -3'

Sequencing Primer
(F):5'- CAGCAAGTGCCAGTGTGTG -3'
(R):5'- AAGGAACAGTGTGCTCCTGTCTC -3'

Posted On

2018-11-28