Incidental Mutation 'R6952:Chit1'
ID543269
Institutional Source Beutler Lab
Gene Symbol Chit1
Ensembl Gene ENSMUSG00000026450
Gene Namechitinase 1 (chitotriosidase)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R6952 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location134111242-134151540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134143284 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 34 (Y34H)
Ref Sequence ENSEMBL: ENSMUSP00000124331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086475] [ENSMUST00000159963] [ENSMUST00000160060]
Predicted Effect probably damaging
Transcript: ENSMUST00000086475
AA Change: Y34H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083666
Gene: ENSMUSG00000026450
AA Change: Y34H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 361 6.69e-151 SMART
ChtBD2 416 464 5.56e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159963
AA Change: Y34H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123979
Gene: ENSMUSG00000026450
AA Change: Y34H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 361 6.69e-151 SMART
ChtBD2 416 464 5.56e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160060
AA Change: Y34H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124331
Gene: ENSMUSG00000026450
AA Change: Y34H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 354 2.47e-131 SMART
Meta Mutation Damage Score 0.7740 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chitotriosidase is secreted by activated human macrophages and is markedly elevated in plasma of Gaucher disease patients. The expression of chitotriosidase occurs only at a late stage of differentiation of monocytes to activated macrophages in culture. Human macrophages can synthesize a functional chitotriosidase, a highly conserved enzyme with a strongly regulated expression. This enzyme may play a role in the degradation of chitin-containing pathogens. Several alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced pulmonary fibrosis induced by bleomycin or IL13 expression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,549,734 probably null Het
Acap1 C A 11: 69,885,517 V219L probably benign Het
Arpp21 G A 9: 112,126,482 P530S probably damaging Het
Atp6v1b1 T C 6: 83,754,810 V224A probably damaging Het
Brd3 T C 2: 27,454,359 D453G probably damaging Het
Btbd10 A T 7: 113,351,943 probably null Het
Ccdc148 T C 2: 58,823,645 H498R probably damaging Het
Cga A T 4: 34,905,171 Y65F possibly damaging Het
Chd7 A T 4: 8,856,797 H136L probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnhd1 T G 7: 105,713,688 V3819G probably damaging Het
Dsg3 A T 18: 20,525,159 I276F possibly damaging Het
Dusp1 T C 17: 26,507,603 S162G probably benign Het
Fam189a2 A T 19: 23,984,718 M307K possibly damaging Het
Gga2 C A 7: 121,998,888 A328S probably benign Het
Gpr183 A G 14: 121,954,485 I208T possibly damaging Het
Haspin T C 11: 73,136,145 D706G possibly damaging Het
Hdac5 T C 11: 102,204,960 I338V probably benign Het
Ik C T 18: 36,753,560 R362C probably damaging Het
Kdm4c T G 4: 74,357,350 C754W probably damaging Het
Lexm C G 4: 106,610,399 probably null Het
Limk1 T A 5: 134,670,478 I142F possibly damaging Het
Mccc2 T C 13: 99,967,726 E305G probably benign Het
Mdm1 A G 10: 118,168,057 D639G probably damaging Het
Mefv T G 16: 3,710,880 T566P probably damaging Het
Mep1b G A 18: 21,088,670 V226I probably benign Het
Mgmt T C 7: 136,951,335 M19T probably benign Het
Mrgpra6 A T 7: 47,185,945 S243T probably benign Het
Myh7 C T 14: 54,991,740 R169Q probably damaging Het
Myo1b T C 1: 51,762,509 I917V probably damaging Het
Olfr1253 A T 2: 89,752,627 M67K possibly damaging Het
Phlpp1 T C 1: 106,172,479 L159P probably benign Het
Plekhh3 T C 11: 101,165,656 E371G probably damaging Het
Rps6ka2 C A 17: 7,227,978 D21E probably benign Het
Slc47a1 T A 11: 61,344,454 M518L probably benign Het
Slitrk6 T C 14: 110,750,542 T578A probably benign Het
Syne2 A T 12: 75,927,431 K1133N possibly damaging Het
Taco1 T C 11: 106,073,116 S234P probably benign Het
Trpv4 G A 5: 114,633,202 S422F probably damaging Het
Tvp23b T A 11: 62,885,126 D97E possibly damaging Het
Vmn1r37 A T 6: 66,731,539 I13L probably benign Het
Vrk2 T A 11: 26,535,597 K130N probably damaging Het
Wdfy4 C T 14: 32,959,966 R3016Q probably damaging Het
Zfp383 T C 7: 29,914,955 S212P probably benign Het
Other mutations in Chit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Chit1 APN 1 134145254 missense probably damaging 1.00
IGL01344:Chit1 APN 1 134151314 missense probably damaging 1.00
IGL01352:Chit1 APN 1 134148490 missense probably damaging 1.00
IGL01620:Chit1 APN 1 134150519 missense probably damaging 1.00
IGL01795:Chit1 APN 1 134148429 missense probably damaging 1.00
IGL01924:Chit1 APN 1 134149410 missense probably benign 0.05
IGL02000:Chit1 APN 1 134146675 missense probably benign 0.01
IGL02891:Chit1 APN 1 134145310 missense probably benign 0.38
Debt UTSW 1 134149425 missense probably null 1.00
R0790:Chit1 UTSW 1 134138752 missense probably benign 0.00
R0838:Chit1 UTSW 1 134143337 nonsense probably null
R1783:Chit1 UTSW 1 134149394 missense possibly damaging 0.67
R1783:Chit1 UTSW 1 134149395 missense probably benign 0.03
R1784:Chit1 UTSW 1 134149394 missense possibly damaging 0.67
R1863:Chit1 UTSW 1 134151250 missense probably damaging 0.96
R1940:Chit1 UTSW 1 134145418 critical splice donor site probably null
R1950:Chit1 UTSW 1 134151230 missense probably damaging 1.00
R2045:Chit1 UTSW 1 134151144 missense probably benign 0.05
R2260:Chit1 UTSW 1 134151127 missense probably benign
R4552:Chit1 UTSW 1 134144051 missense probably benign 0.17
R5386:Chit1 UTSW 1 134149454 missense probably damaging 1.00
R5975:Chit1 UTSW 1 134146626 missense probably damaging 1.00
R6134:Chit1 UTSW 1 134144060 missense possibly damaging 0.94
R6196:Chit1 UTSW 1 134146643 nonsense probably null
R6482:Chit1 UTSW 1 134143242 missense probably damaging 0.98
R6923:Chit1 UTSW 1 134149425 missense probably null 1.00
R7022:Chit1 UTSW 1 134151292 missense probably benign 0.44
R7198:Chit1 UTSW 1 134150491 missense possibly damaging 0.87
R8079:Chit1 UTSW 1 134144027 missense possibly damaging 0.79
R8278:Chit1 UTSW 1 134150594 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTGTGTTTATTTCTACCTGTCAG -3'
(R):5'- ATGATGGAGAGCTTTCTGGAC -3'

Sequencing Primer
(F):5'- GCCCTTAGCCTCGGTACCTAAG -3'
(R):5'- AGAGCTTTCTGGACAGGGC -3'
Posted On2018-11-28