Incidental Mutation 'R6952:Cga'
ID543274
Institutional Source Beutler Lab
Gene Symbol Cga
Ensembl Gene ENSMUSG00000028298
Gene Nameglycoprotein hormones, alpha subunit
SynonymsGPHalpha, alphaSU, aGSU, alphaGSU, alpha-GSU, Tsha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.856) question?
Stock #R6952 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location34893779-34907370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34905171 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 65 (Y65F)
Ref Sequence ENSEMBL: ENSMUSP00000119152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029975] [ENSMUST00000108130] [ENSMUST00000135871]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029975
AA Change: Y65F

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029975
Gene: ENSMUSG00000028298
AA Change: Y65F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GHA 34 120 3.31e-57 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108130
AA Change: Y65F

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103765
Gene: ENSMUSG00000028298
AA Change: Y65F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GHA 34 120 3.31e-57 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135871
AA Change: Y65F

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119152
Gene: ENSMUSG00000028298
AA Change: Y65F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GHA 34 117 7.56e-52 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mutants exhibit male and female sterility with hypogonadism, dwarfism, hypothyroidism, and both hypertrophy and hyperplasia of pituitary thyrotropes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,549,734 probably null Het
Acap1 C A 11: 69,885,517 V219L probably benign Het
Arpp21 G A 9: 112,126,482 P530S probably damaging Het
Atp6v1b1 T C 6: 83,754,810 V224A probably damaging Het
Brd3 T C 2: 27,454,359 D453G probably damaging Het
Btbd10 A T 7: 113,351,943 probably null Het
Ccdc148 T C 2: 58,823,645 H498R probably damaging Het
Chd7 A T 4: 8,856,797 H136L probably damaging Het
Chit1 T C 1: 134,143,284 Y34H probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnhd1 T G 7: 105,713,688 V3819G probably damaging Het
Dsg3 A T 18: 20,525,159 I276F possibly damaging Het
Dusp1 T C 17: 26,507,603 S162G probably benign Het
Fam189a2 A T 19: 23,984,718 M307K possibly damaging Het
Gga2 C A 7: 121,998,888 A328S probably benign Het
Gpr183 A G 14: 121,954,485 I208T possibly damaging Het
Haspin T C 11: 73,136,145 D706G possibly damaging Het
Hdac5 T C 11: 102,204,960 I338V probably benign Het
Ik C T 18: 36,753,560 R362C probably damaging Het
Kdm4c T G 4: 74,357,350 C754W probably damaging Het
Lexm C G 4: 106,610,399 probably null Het
Limk1 T A 5: 134,670,478 I142F possibly damaging Het
Mccc2 T C 13: 99,967,726 E305G probably benign Het
Mdm1 A G 10: 118,168,057 D639G probably damaging Het
Mefv T G 16: 3,710,880 T566P probably damaging Het
Mep1b G A 18: 21,088,670 V226I probably benign Het
Mgmt T C 7: 136,951,335 M19T probably benign Het
Mrgpra6 A T 7: 47,185,945 S243T probably benign Het
Myh7 C T 14: 54,991,740 R169Q probably damaging Het
Myo1b T C 1: 51,762,509 I917V probably damaging Het
Olfr1253 A T 2: 89,752,627 M67K possibly damaging Het
Phlpp1 T C 1: 106,172,479 L159P probably benign Het
Plekhh3 T C 11: 101,165,656 E371G probably damaging Het
Rps6ka2 C A 17: 7,227,978 D21E probably benign Het
Slc47a1 T A 11: 61,344,454 M518L probably benign Het
Slitrk6 T C 14: 110,750,542 T578A probably benign Het
Syne2 A T 12: 75,927,431 K1133N possibly damaging Het
Taco1 T C 11: 106,073,116 S234P probably benign Het
Trpv4 G A 5: 114,633,202 S422F probably damaging Het
Tvp23b T A 11: 62,885,126 D97E possibly damaging Het
Vmn1r37 A T 6: 66,731,539 I13L probably benign Het
Vrk2 T A 11: 26,535,597 K130N probably damaging Het
Wdfy4 C T 14: 32,959,966 R3016Q probably damaging Het
Zfp383 T C 7: 29,914,955 S212P probably benign Het
Other mutations in Cga
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4283:Cga UTSW 4 34905264 critical splice donor site probably null
R5382:Cga UTSW 4 34904048 missense probably benign
R5743:Cga UTSW 4 34904108 critical splice donor site probably null
R7388:Cga UTSW 4 34907076 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGTTTCTCTGTGAACATAGC -3'
(R):5'- ACGGAGCAACAAATCCTGGTC -3'

Sequencing Primer
(F):5'- AAGCATCTGTCATGTCGTACCTAGG -3'
(R):5'- GTCACCAGACAGCTTGCCATG -3'
Posted On2018-11-28