Incidental Mutation 'R6952:Mrgpra6'
ID543282
Institutional Source Beutler Lab
Gene Symbol Mrgpra6
Ensembl Gene ENSMUSG00000052303
Gene NameMAS-related GPR, member A6
SynonymsMrgA6
MMRRC Submission
Accession Numbers

Genbank: NM_205821; MGI: 3033107

Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6952 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location47185707-47204920 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47185945 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 243 (S243T)
Ref Sequence ENSEMBL: ENSMUSP00000073463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073793] [ENSMUST00000186456]
Predicted Effect probably benign
Transcript: ENSMUST00000073793
AA Change: S243T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000073463
Gene: ENSMUSG00000052303
AA Change: S243T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 17 198 5.9e-8 PFAM
Pfam:7tm_1 26 258 5.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186456
SMART Domains Protein: ENSMUSP00000140353
Gene: ENSMUSG00000052303

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 48 228 1.1e-5 PFAM
Pfam:7tm_1 57 270 1e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,549,734 probably null Het
Acap1 C A 11: 69,885,517 V219L probably benign Het
Arpp21 G A 9: 112,126,482 P530S probably damaging Het
Atp6v1b1 T C 6: 83,754,810 V224A probably damaging Het
Brd3 T C 2: 27,454,359 D453G probably damaging Het
Btbd10 A T 7: 113,351,943 probably null Het
Ccdc148 T C 2: 58,823,645 H498R probably damaging Het
Cga A T 4: 34,905,171 Y65F possibly damaging Het
Chd7 A T 4: 8,856,797 H136L probably damaging Het
Chit1 T C 1: 134,143,284 Y34H probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnhd1 T G 7: 105,713,688 V3819G probably damaging Het
Dsg3 A T 18: 20,525,159 I276F possibly damaging Het
Dusp1 T C 17: 26,507,603 S162G probably benign Het
Fam189a2 A T 19: 23,984,718 M307K possibly damaging Het
Gga2 C A 7: 121,998,888 A328S probably benign Het
Gpr183 A G 14: 121,954,485 I208T possibly damaging Het
Haspin T C 11: 73,136,145 D706G possibly damaging Het
Hdac5 T C 11: 102,204,960 I338V probably benign Het
Ik C T 18: 36,753,560 R362C probably damaging Het
Kdm4c T G 4: 74,357,350 C754W probably damaging Het
Lexm C G 4: 106,610,399 probably null Het
Limk1 T A 5: 134,670,478 I142F possibly damaging Het
Mccc2 T C 13: 99,967,726 E305G probably benign Het
Mdm1 A G 10: 118,168,057 D639G probably damaging Het
Mefv T G 16: 3,710,880 T566P probably damaging Het
Mep1b G A 18: 21,088,670 V226I probably benign Het
Mgmt T C 7: 136,951,335 M19T probably benign Het
Myh7 C T 14: 54,991,740 R169Q probably damaging Het
Myo1b T C 1: 51,762,509 I917V probably damaging Het
Olfr1253 A T 2: 89,752,627 M67K possibly damaging Het
Phlpp1 T C 1: 106,172,479 L159P probably benign Het
Plekhh3 T C 11: 101,165,656 E371G probably damaging Het
Rps6ka2 C A 17: 7,227,978 D21E probably benign Het
Slc47a1 T A 11: 61,344,454 M518L probably benign Het
Slitrk6 T C 14: 110,750,542 T578A probably benign Het
Syne2 A T 12: 75,927,431 K1133N possibly damaging Het
Taco1 T C 11: 106,073,116 S234P probably benign Het
Trpv4 G A 5: 114,633,202 S422F probably damaging Het
Tvp23b T A 11: 62,885,126 D97E possibly damaging Het
Vmn1r37 A T 6: 66,731,539 I13L probably benign Het
Vrk2 T A 11: 26,535,597 K130N probably damaging Het
Wdfy4 C T 14: 32,959,966 R3016Q probably damaging Het
Zfp383 T C 7: 29,914,955 S212P probably benign Het
Other mutations in Mrgpra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01645:Mrgpra6 APN 7 47185933 missense probably benign 0.00
IGL01780:Mrgpra6 APN 7 47188749 missense probably damaging 1.00
IGL01801:Mrgpra6 APN 7 47185824 missense possibly damaging 0.90
IGL02158:Mrgpra6 APN 7 47185952 nonsense probably null
IGL02715:Mrgpra6 APN 7 47188648 splice site probably benign
IGL02896:Mrgpra6 APN 7 47188907 missense probably benign 0.02
D4216:Mrgpra6 UTSW 7 47188756 missense probably damaging 0.96
R1566:Mrgpra6 UTSW 7 47188904 missense probably benign 0.02
R4016:Mrgpra6 UTSW 7 47188715 missense possibly damaging 0.76
R5051:Mrgpra6 UTSW 7 47185942 missense probably benign 0.00
R5384:Mrgpra6 UTSW 7 47188881 missense probably damaging 1.00
R5386:Mrgpra6 UTSW 7 47188881 missense probably damaging 1.00
R5638:Mrgpra6 UTSW 7 47185909 missense probably damaging 1.00
R5860:Mrgpra6 UTSW 7 47189351 missense probably benign 0.41
R6633:Mrgpra6 UTSW 7 47188745 missense possibly damaging 0.89
R6980:Mrgpra6 UTSW 7 47188949 missense probably damaging 0.97
Z1177:Mrgpra6 UTSW 7 47189162 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AGGCTCTTCATCACAGCTCTG -3'
(R):5'- TTGGACACGCAGACTTTGTG -3'

Sequencing Primer
(F):5'- ACAGCTCTGCTTTGTTTCTTGACATC -3'
(R):5'- AGACTTTGTGTGCCCCGGTAC -3'
Posted On2018-11-28