Incidental Mutation 'R6952:Gga2'
ID543284
Institutional Source Beutler Lab
Gene Symbol Gga2
Ensembl Gene ENSMUSG00000030872
Gene Namegolgi associated, gamma adaptin ear containing, ARF binding protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6952 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location121986722-122021222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121998888 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 328 (A328S)
Ref Sequence ENSEMBL: ENSMUSP00000115581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033160] [ENSMUST00000124566]
Predicted Effect probably benign
Transcript: ENSMUST00000033160
AA Change: A328S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000033160
Gene: ENSMUSG00000030872
AA Change: A328S

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
VHS 29 162 2.45e-58 SMART
Pfam:GAT 241 318 2.2e-20 PFAM
low complexity region 320 338 N/A INTRINSIC
Alpha_adaptinC2 471 595 8.68e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124566
AA Change: A328S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000115581
Gene: ENSMUSG00000030872
AA Change: A328S

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
VHS 29 162 2.45e-58 SMART
Pfam:GAT 225 326 1.3e-30 PFAM
Alpha_adaptinC2 471 595 8.68e-39 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) family. This family includes ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. This family member may play a significant role in cargo molecules regulation and clathrin-coated vesicle assembly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality. Mice homozygous for a different gene trapped allele show decreased birth weight, hypoglycemia and partial neonatal lethality, with all remaining mice dying within the first three weeks of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T G 16: 20,549,734 probably null Het
Acap1 C A 11: 69,885,517 V219L probably benign Het
Arpp21 G A 9: 112,126,482 P530S probably damaging Het
Atp6v1b1 T C 6: 83,754,810 V224A probably damaging Het
Brd3 T C 2: 27,454,359 D453G probably damaging Het
Btbd10 A T 7: 113,351,943 probably null Het
Ccdc148 T C 2: 58,823,645 H498R probably damaging Het
Cga A T 4: 34,905,171 Y65F possibly damaging Het
Chd7 A T 4: 8,856,797 H136L probably damaging Het
Chit1 T C 1: 134,143,284 Y34H probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnhd1 T G 7: 105,713,688 V3819G probably damaging Het
Dsg3 A T 18: 20,525,159 I276F possibly damaging Het
Dusp1 T C 17: 26,507,603 S162G probably benign Het
Fam189a2 A T 19: 23,984,718 M307K possibly damaging Het
Gpr183 A G 14: 121,954,485 I208T possibly damaging Het
Haspin T C 11: 73,136,145 D706G possibly damaging Het
Hdac5 T C 11: 102,204,960 I338V probably benign Het
Ik C T 18: 36,753,560 R362C probably damaging Het
Kdm4c T G 4: 74,357,350 C754W probably damaging Het
Lexm C G 4: 106,610,399 probably null Het
Limk1 T A 5: 134,670,478 I142F possibly damaging Het
Mccc2 T C 13: 99,967,726 E305G probably benign Het
Mdm1 A G 10: 118,168,057 D639G probably damaging Het
Mefv T G 16: 3,710,880 T566P probably damaging Het
Mep1b G A 18: 21,088,670 V226I probably benign Het
Mgmt T C 7: 136,951,335 M19T probably benign Het
Mrgpra6 A T 7: 47,185,945 S243T probably benign Het
Myh7 C T 14: 54,991,740 R169Q probably damaging Het
Myo1b T C 1: 51,762,509 I917V probably damaging Het
Olfr1253 A T 2: 89,752,627 M67K possibly damaging Het
Phlpp1 T C 1: 106,172,479 L159P probably benign Het
Plekhh3 T C 11: 101,165,656 E371G probably damaging Het
Rps6ka2 C A 17: 7,227,978 D21E probably benign Het
Slc47a1 T A 11: 61,344,454 M518L probably benign Het
Slitrk6 T C 14: 110,750,542 T578A probably benign Het
Syne2 A T 12: 75,927,431 K1133N possibly damaging Het
Taco1 T C 11: 106,073,116 S234P probably benign Het
Trpv4 G A 5: 114,633,202 S422F probably damaging Het
Tvp23b T A 11: 62,885,126 D97E possibly damaging Het
Vmn1r37 A T 6: 66,731,539 I13L probably benign Het
Vrk2 T A 11: 26,535,597 K130N probably damaging Het
Wdfy4 C T 14: 32,959,966 R3016Q probably damaging Het
Zfp383 T C 7: 29,914,955 S212P probably benign Het
Other mutations in Gga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Gga2 APN 7 122002188 missense probably damaging 1.00
IGL01577:Gga2 APN 7 121989783 missense probably damaging 1.00
IGL01584:Gga2 APN 7 121991538 missense probably benign
IGL01671:Gga2 APN 7 121994856 missense probably benign 0.01
IGL01680:Gga2 APN 7 121998076 missense probably benign 0.06
IGL02745:Gga2 APN 7 122008369 missense probably damaging 1.00
R0122:Gga2 UTSW 7 121991574 missense probably damaging 1.00
R0218:Gga2 UTSW 7 121998900 missense possibly damaging 0.46
R1367:Gga2 UTSW 7 121998915 nonsense probably null
R1774:Gga2 UTSW 7 122012221 missense probably damaging 0.98
R4127:Gga2 UTSW 7 122002720 missense probably damaging 1.00
R4510:Gga2 UTSW 7 122021078 missense unknown
R6319:Gga2 UTSW 7 122002166 missense possibly damaging 0.92
R6395:Gga2 UTSW 7 122008438 splice site probably null
R6486:Gga2 UTSW 7 122002188 missense probably damaging 1.00
R7035:Gga2 UTSW 7 121989716 missense probably damaging 1.00
R7320:Gga2 UTSW 7 122002103 missense probably benign
R7454:Gga2 UTSW 7 122002146 missense probably benign 0.00
R7593:Gga2 UTSW 7 121990449 missense probably benign 0.00
R7602:Gga2 UTSW 7 121997330 missense probably benign 0.05
R7638:Gga2 UTSW 7 122003934 missense probably damaging 1.00
R7736:Gga2 UTSW 7 121990524 missense probably damaging 1.00
R8032:Gga2 UTSW 7 122020987 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCATGGTAGAGCTCTAACCTGC -3'
(R):5'- TAGGAAGTTGGACACATGACC -3'

Sequencing Primer
(F):5'- TAGAGCTCTAACCTGCCATGG -3'
(R):5'- TTTCCTCAGCGGAGATTC -3'
Posted On2018-11-28