Incidental Mutation 'R6963:Ccdc144b'
ID543315
Institutional Source Beutler Lab
Gene Symbol Ccdc144b
Ensembl Gene ENSMUSG00000047696
Gene Namecoiled-coil domain containing 144B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6963 (G1)
Quality Score187.009
Status Validated
Chromosome3
Chromosomal Location36007244-36053547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36050662 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 17 (Y17H)
Ref Sequence ENSEMBL: ENSMUSP00000142406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166644] [ENSMUST00000196964] [ENSMUST00000200469]
Predicted Effect probably benign
Transcript: ENSMUST00000166644
AA Change: Y17H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132995
Gene: ENSMUSG00000047696
AA Change: Y17H

DomainStartEndE-ValueType
coiled coil region 65 97 N/A INTRINSIC
coiled coil region 121 166 N/A INTRINSIC
coiled coil region 231 327 N/A INTRINSIC
Pfam:DUF3496 381 488 1.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196964
AA Change: Y17H

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142406
Gene: ENSMUSG00000047696
AA Change: Y17H

DomainStartEndE-ValueType
coiled coil region 65 97 N/A INTRINSIC
coiled coil region 121 166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200469
AA Change: Y17H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000142910
Gene: ENSMUSG00000047696
AA Change: Y17H

DomainStartEndE-ValueType
coiled coil region 65 97 N/A INTRINSIC
coiled coil region 121 166 N/A INTRINSIC
coiled coil region 231 327 N/A INTRINSIC
Pfam:DUF3496 381 488 1.6e-45 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,896,456 H196Y probably damaging Het
Abi3 G A 11: 95,832,741 probably benign Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Asgr1 T C 11: 70,055,968 probably null Het
Atp2c2 C T 8: 119,730,267 R203* probably null Het
Brms1 T A 19: 5,046,653 I121N probably damaging Het
Ccdc149 G A 5: 52,439,097 R58W probably damaging Het
D630003M21Rik T C 2: 158,200,308 E906G probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fry A G 5: 150,457,844 T444A probably benign Het
Ggn A G 7: 29,171,582 E142G probably damaging Het
Gm21994 A G 2: 150,255,345 C55R probably damaging Het
Gm5150 A G 3: 16,006,391 probably benign Het
Gp2 A G 7: 119,452,897 V198A probably benign Het
Gstm3 A G 3: 107,967,624 V104A probably benign Het
Idua A G 5: 108,679,775 K152E possibly damaging Het
Igsf21 A G 4: 140,027,730 S443P probably benign Het
Kdm5d C A Y: 937,975 Q925K probably benign Het
Ly6k G C 15: 74,798,582 P37R probably damaging Het
Mcm9 A G 10: 53,548,617 S626P probably damaging Het
Mcoln2 A G 3: 146,172,035 K137R probably damaging Het
Mctp2 T C 7: 72,228,056 N298S probably damaging Het
Mpp6 T C 6: 50,163,655 probably null Het
Myo10 T C 15: 25,734,063 I379T probably benign Het
Myo15b G T 11: 115,890,714 probably null Het
Nrg1 A G 8: 31,917,662 F181S probably benign Het
Olfr1449 C T 19: 12,935,638 A300V probably damaging Het
Pde9a G T 17: 31,443,887 V97L probably benign Het
Rfc5 T A 5: 117,387,866 probably null Het
Rnf145 T C 11: 44,564,277 S662P probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scfd2 A G 5: 74,482,209 V359A probably damaging Het
Skp2 T C 15: 9,139,428 probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tekt2 T C 4: 126,324,317 E134G probably damaging Het
Ttll4 T A 1: 74,681,816 I547K probably damaging Het
Vmn1r4 T C 6: 56,956,784 I91T probably damaging Het
Vmn2r93 T C 17: 18,316,587 S511P probably damaging Het
Vps50 T C 6: 3,592,577 probably null Het
Zeb2 T G 2: 44,988,799 E1141A probably damaging Het
Zfp326 T A 5: 105,911,493 Y373* probably null Het
Other mutations in Ccdc144b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Ccdc144b APN 3 36019989 missense probably damaging 1.00
IGL00773:Ccdc144b APN 3 36035337 missense probably damaging 1.00
IGL01409:Ccdc144b APN 3 36025928 missense possibly damaging 0.77
IGL01791:Ccdc144b APN 3 36035267 critical splice donor site probably benign 0.00
IGL02307:Ccdc144b APN 3 36018867 missense possibly damaging 0.95
IGL02374:Ccdc144b APN 3 36019959 missense possibly damaging 0.83
IGL02673:Ccdc144b APN 3 36046699 splice site probably benign
IGL02727:Ccdc144b APN 3 36032916 missense possibly damaging 0.66
R0355:Ccdc144b UTSW 3 36046905 splice site probably benign
R0833:Ccdc144b UTSW 3 36020213 splice site probably benign
R0928:Ccdc144b UTSW 3 36025366 missense possibly damaging 0.83
R1595:Ccdc144b UTSW 3 36018997 missense probably damaging 0.99
R1598:Ccdc144b UTSW 3 36018997 missense probably damaging 0.99
R2011:Ccdc144b UTSW 3 36010678 nonsense probably null
R2255:Ccdc144b UTSW 3 36019950 missense probably benign 0.00
R2921:Ccdc144b UTSW 3 36025928 missense probably null 0.01
R4659:Ccdc144b UTSW 3 36025954 missense possibly damaging 0.90
R4764:Ccdc144b UTSW 3 36010660 makesense probably null
R4929:Ccdc144b UTSW 3 36035338 missense probably damaging 0.99
R5631:Ccdc144b UTSW 3 36046877 missense probably damaging 0.99
R5755:Ccdc144b UTSW 3 36017693 missense probably benign
R5849:Ccdc144b UTSW 3 36032877 missense possibly damaging 0.81
R5894:Ccdc144b UTSW 3 36019975 missense possibly damaging 0.91
R5968:Ccdc144b UTSW 3 36010691 missense probably benign 0.00
R6961:Ccdc144b UTSW 3 36050617 missense possibly damaging 0.66
R7248:Ccdc144b UTSW 3 36025937 missense probably benign 0.00
R7380:Ccdc144b UTSW 3 36025921 missense possibly damaging 0.68
R7462:Ccdc144b UTSW 3 36025906 splice site probably null
R7612:Ccdc144b UTSW 3 36025357 missense possibly damaging 0.79
R7637:Ccdc144b UTSW 3 36046876 missense probably damaging 0.98
R8025:Ccdc144b UTSW 3 36018987 missense probably damaging 0.97
X0011:Ccdc144b UTSW 3 36025948 missense possibly damaging 0.66
X0057:Ccdc144b UTSW 3 36018901 nonsense probably null
Z1176:Ccdc144b UTSW 3 36018888 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CTTAAGTGTATAGCATGTCTCTGAC -3'
(R):5'- GAAATATTGGTTCATGGGTAGTTCC -3'

Sequencing Primer
(F):5'- TGTCTCTGACATGGCGGCAC -3'
(R):5'- GGTAGTTCCCTTCTGATGAAACATC -3'
Posted On2018-11-28