Incidental Mutation 'R6963:Gstm3'
ID543316
Institutional Source Beutler Lab
Gene Symbol Gstm3
Ensembl Gene ENSMUSG00000004038
Gene Nameglutathione S-transferase, mu 3
SynonymsmGSTM5, Fsc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6963 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location107963696-107969283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107967624 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 104 (V104A)
Ref Sequence ENSEMBL: ENSMUSP00000004136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004136]
Predicted Effect probably benign
Transcript: ENSMUST00000004136
AA Change: V104A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000004136
Gene: ENSMUSG00000004038
AA Change: V104A

DomainStartEndE-ValueType
Pfam:GST_N 3 82 6.6e-22 PFAM
Pfam:GST_C_3 41 190 7.7e-11 PFAM
Pfam:GST_C 104 191 1.6e-17 PFAM
Meta Mutation Damage Score 0.0629 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,896,456 H196Y probably damaging Het
Abi3 G A 11: 95,832,741 probably benign Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Asgr1 T C 11: 70,055,968 probably null Het
Atp2c2 C T 8: 119,730,267 R203* probably null Het
Brms1 T A 19: 5,046,653 I121N probably damaging Het
Ccdc144b A G 3: 36,050,662 Y17H probably benign Het
Ccdc149 G A 5: 52,439,097 R58W probably damaging Het
D630003M21Rik T C 2: 158,200,308 E906G probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fry A G 5: 150,457,844 T444A probably benign Het
Ggn A G 7: 29,171,582 E142G probably damaging Het
Gm21994 A G 2: 150,255,345 C55R probably damaging Het
Gm5150 A G 3: 16,006,391 probably benign Het
Gp2 A G 7: 119,452,897 V198A probably benign Het
Idua A G 5: 108,679,775 K152E possibly damaging Het
Igsf21 A G 4: 140,027,730 S443P probably benign Het
Kdm5d C A Y: 937,975 Q925K probably benign Het
Ly6k G C 15: 74,798,582 P37R probably damaging Het
Mcm9 A G 10: 53,548,617 S626P probably damaging Het
Mcoln2 A G 3: 146,172,035 K137R probably damaging Het
Mctp2 T C 7: 72,228,056 N298S probably damaging Het
Mpp6 T C 6: 50,163,655 probably null Het
Myo10 T C 15: 25,734,063 I379T probably benign Het
Myo15b G T 11: 115,890,714 probably null Het
Nrg1 A G 8: 31,917,662 F181S probably benign Het
Olfr1449 C T 19: 12,935,638 A300V probably damaging Het
Pde9a G T 17: 31,443,887 V97L probably benign Het
Rfc5 T A 5: 117,387,866 probably null Het
Rnf145 T C 11: 44,564,277 S662P probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scfd2 A G 5: 74,482,209 V359A probably damaging Het
Skp2 T C 15: 9,139,428 probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tekt2 T C 4: 126,324,317 E134G probably damaging Het
Ttll4 T A 1: 74,681,816 I547K probably damaging Het
Vmn1r4 T C 6: 56,956,784 I91T probably damaging Het
Vmn2r93 T C 17: 18,316,587 S511P probably damaging Het
Vps50 T C 6: 3,592,577 probably null Het
Zeb2 T G 2: 44,988,799 E1141A probably damaging Het
Zfp326 T A 5: 105,911,493 Y373* probably null Het
Other mutations in Gstm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Gstm3 APN 3 107966158 missense probably benign 0.42
IGL01637:Gstm3 APN 3 107967633 missense probably damaging 1.00
IGL01937:Gstm3 APN 3 107967657 missense probably damaging 0.98
IGL01945:Gstm3 APN 3 107967657 missense probably damaging 0.98
IGL02307:Gstm3 APN 3 107967613 missense probably damaging 0.98
IGL02820:Gstm3 APN 3 107968758 splice site probably benign
IGL03038:Gstm3 APN 3 107966169 missense possibly damaging 0.75
IGL03108:Gstm3 APN 3 107967764 critical splice donor site probably null
IGL03271:Gstm3 APN 3 107966197 missense possibly damaging 0.47
IGL03097:Gstm3 UTSW 3 107968801 missense probably benign
R0009:Gstm3 UTSW 3 107967840 missense probably damaging 1.00
R0883:Gstm3 UTSW 3 107966270 splice site probably benign
R1623:Gstm3 UTSW 3 107967835 missense possibly damaging 0.80
R2108:Gstm3 UTSW 3 107966134 missense probably damaging 0.99
R3005:Gstm3 UTSW 3 107967607 missense probably benign 0.03
R3802:Gstm3 UTSW 3 107964235 missense probably benign 0.03
R3803:Gstm3 UTSW 3 107964235 missense probably benign 0.03
R3804:Gstm3 UTSW 3 107964235 missense probably benign 0.03
R4604:Gstm3 UTSW 3 107968197 missense possibly damaging 0.73
R4837:Gstm3 UTSW 3 107964215 missense probably benign
R6593:Gstm3 UTSW 3 107968195 missense probably benign 0.01
R7790:Gstm3 UTSW 3 107969239 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGGTAAGATCCGAAAGCTTGG -3'
(R):5'- AGCTGCCCTACTTAATTGATGG -3'

Sequencing Primer
(F):5'- CTTGGAGAATCAGTAACATGGCTCC -3'
(R):5'- TTGATGGGTCACACAAGGTCACC -3'
Posted On2018-11-28