Incidental Mutation 'R6963:Igsf21'
ID543320
Institutional Source Beutler Lab
Gene Symbol Igsf21
Ensembl Gene ENSMUSG00000040972
Gene Nameimmunoglobulin superfamily, member 21
SynonymsLOC230868
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6963 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location140026846-140246784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140027730 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 443 (S443P)
Ref Sequence ENSEMBL: ENSMUSP00000046558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039331]
Predicted Effect probably benign
Transcript: ENSMUST00000039331
AA Change: S443P

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000046558
Gene: ENSMUSG00000040972
AA Change: S443P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 141 1.93e-5 SMART
IG 348 431 2.38e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which has two immunoglobulin (Ig) domains and is a member of the immunoglobulin superfamily. Proteins in this superfamily are usually found on or in cell membranes and act as receptors in immune response pathways. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal differentiation of inhibitory synapses with decreased mIPSC frequency and prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,896,456 H196Y probably damaging Het
Abi3 G A 11: 95,832,741 probably benign Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Asgr1 T C 11: 70,055,968 probably null Het
Atp2c2 C T 8: 119,730,267 R203* probably null Het
Brms1 T A 19: 5,046,653 I121N probably damaging Het
Ccdc144b A G 3: 36,050,662 Y17H probably benign Het
Ccdc149 G A 5: 52,439,097 R58W probably damaging Het
D630003M21Rik T C 2: 158,200,308 E906G probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fry A G 5: 150,457,844 T444A probably benign Het
Ggn A G 7: 29,171,582 E142G probably damaging Het
Gm21994 A G 2: 150,255,345 C55R probably damaging Het
Gm5150 A G 3: 16,006,391 probably benign Het
Gp2 A G 7: 119,452,897 V198A probably benign Het
Gstm3 A G 3: 107,967,624 V104A probably benign Het
Idua A G 5: 108,679,775 K152E possibly damaging Het
Kdm5d C A Y: 937,975 Q925K probably benign Het
Ly6k G C 15: 74,798,582 P37R probably damaging Het
Mcm9 A G 10: 53,548,617 S626P probably damaging Het
Mcoln2 A G 3: 146,172,035 K137R probably damaging Het
Mctp2 T C 7: 72,228,056 N298S probably damaging Het
Mpp6 T C 6: 50,163,655 probably null Het
Myo10 T C 15: 25,734,063 I379T probably benign Het
Myo15b G T 11: 115,890,714 probably null Het
Nrg1 A G 8: 31,917,662 F181S probably benign Het
Olfr1449 C T 19: 12,935,638 A300V probably damaging Het
Pde9a G T 17: 31,443,887 V97L probably benign Het
Rfc5 T A 5: 117,387,866 probably null Het
Rnf145 T C 11: 44,564,277 S662P probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scfd2 A G 5: 74,482,209 V359A probably damaging Het
Skp2 T C 15: 9,139,428 probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tekt2 T C 4: 126,324,317 E134G probably damaging Het
Ttll4 T A 1: 74,681,816 I547K probably damaging Het
Vmn1r4 T C 6: 56,956,784 I91T probably damaging Het
Vmn2r93 T C 17: 18,316,587 S511P probably damaging Het
Vps50 T C 6: 3,592,577 probably null Het
Zeb2 T G 2: 44,988,799 E1141A probably damaging Het
Zfp326 T A 5: 105,911,493 Y373* probably null Het
Other mutations in Igsf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Igsf21 APN 4 140027718 splice site probably benign
IGL01613:Igsf21 APN 4 140107364 missense possibly damaging 0.75
IGL01618:Igsf21 APN 4 140107364 missense possibly damaging 0.75
R1458:Igsf21 UTSW 4 140028124 missense probably damaging 1.00
R1464:Igsf21 UTSW 4 140034525 missense probably benign
R1464:Igsf21 UTSW 4 140034525 missense probably benign
R1793:Igsf21 UTSW 4 140034392 missense probably damaging 1.00
R1913:Igsf21 UTSW 4 140107312 missense probably benign
R2220:Igsf21 UTSW 4 140028114 missense probably damaging 1.00
R4013:Igsf21 UTSW 4 140037469 missense possibly damaging 0.92
R4721:Igsf21 UTSW 4 140107310 missense probably benign 0.09
R4911:Igsf21 UTSW 4 140034623 missense probably benign 0.01
R5157:Igsf21 UTSW 4 140028067 missense possibly damaging 0.53
R5725:Igsf21 UTSW 4 140034743 missense probably benign 0.02
R5778:Igsf21 UTSW 4 140037521 missense probably benign 0.28
R5804:Igsf21 UTSW 4 140028074 missense possibly damaging 0.70
R6140:Igsf21 UTSW 4 140107373 missense probably benign 0.10
R6778:Igsf21 UTSW 4 140034648 missense probably benign 0.05
R6888:Igsf21 UTSW 4 140034743 missense probably benign 0.02
R7203:Igsf21 UTSW 4 140107337 missense possibly damaging 0.70
R7485:Igsf21 UTSW 4 140027738 missense probably benign 0.09
R7880:Igsf21 UTSW 4 140157508 missense probably damaging 1.00
R7963:Igsf21 UTSW 4 140157508 missense probably damaging 1.00
Z1176:Igsf21 UTSW 4 140067215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCCCATTGGCTGTTTGG -3'
(R):5'- TCCAGGTTCACATCTCAGCC -3'

Sequencing Primer
(F):5'- AGACTTCCTTGCTTAGTGCCTAGAG -3'
(R):5'- GGTTCACATCTCAGCCACTCAG -3'
Posted On2018-11-28