Mutagenetix > Incidental Mutation

Incidental Mutation 'R6963:Atp2c2'

543334

Institutional Source

Beutler Lab

Gene Symbol

Atp2c2

Ensembl Gene

ENSMUSG00000034112

Gene Name

ATPase, Ca++ transporting, type 2C, member 2

Synonyms

MMRRC Submission

045073-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6963 (G1)

Quality Score

178.009

Status

Validated

Chromosome

Chromosomal Location

119700009-119757717 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 119730267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 203 (R203*)

Ref Sequence

ENSEMBL: ENSMUSP00000092794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095171] [ENSMUST00000212454]

AlphaFold

A7L9Z8

Predicted Effect

probably null
Transcript: ENSMUST00000095171
AA Change: R203*

SMART Domains

Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: R203*

Domain	Start	End	E-Value	Type
Cation_ATPase_N	54	128	1.27e-12	SMART
Pfam:E1-E2_ATPase	133	366	1.7e-62	PFAM
Pfam:Hydrolase	371	684	5.3e-18	PFAM
Pfam:HAD	374	681	7.4e-11	PFAM
Pfam:Cation_ATPase	437	521	1.1e-17	PFAM
Pfam:Cation_ATPase_C	754	927	1.1e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212454

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

100% (41/41)

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	G	A	5: 76,896,456	H196Y	probably damaging	Het
Abi3	G	A	11: 95,832,741		probably benign	Het
Adgrb2	CG	C	4: 130,014,362		probably null	Het
Asgr1	T	C	11: 70,055,968		probably null	Het
Brms1	T	A	19: 5,046,653	I121N	probably damaging	Het
Ccdc144b	A	G	3: 36,050,662	Y17H	probably benign	Het
Ccdc149	G	A	5: 52,439,097	R58W	probably damaging	Het
D630003M21Rik	T	C	2: 158,200,308	E906G	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Fry	A	G	5: 150,457,844	T444A	probably benign	Het
Ggn	A	G	7: 29,171,582	E142G	probably damaging	Het
Gm21994	A	G	2: 150,255,345	C55R	probably damaging	Het
Gm5150	A	G	3: 16,006,391		probably benign	Het
Gp2	A	G	7: 119,452,897	V198A	probably benign	Het
Gstm3	A	G	3: 107,967,624	V104A	probably benign	Het
Idua	A	G	5: 108,679,775	K152E	possibly damaging	Het
Igsf21	A	G	4: 140,027,730	S443P	probably benign	Het
Kdm5d	C	A	Y: 937,975	Q925K	probably benign	Het
Ly6k	G	C	15: 74,798,582	P37R	probably damaging	Het
Mcm9	A	G	10: 53,548,617	S626P	probably damaging	Het
Mcoln2	A	G	3: 146,172,035	K137R	probably damaging	Het
Mctp2	T	C	7: 72,228,056	N298S	probably damaging	Het
Mpp6	T	C	6: 50,163,655		probably null	Het
Myo10	T	C	15: 25,734,063	I379T	probably benign	Het
Myo15b	G	T	11: 115,890,714		probably null	Het
Nrg1	A	G	8: 31,917,662	F181S	probably benign	Het
Olfr1449	C	T	19: 12,935,638	A300V	probably damaging	Het
Pde9a	G	T	17: 31,443,887	V97L	probably benign	Het
Rfc5	T	A	5: 117,387,866		probably null	Het
Rnf145	T	C	11: 44,564,277	S662P	probably benign	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Scfd2	A	G	5: 74,482,209	V359A	probably damaging	Het
Skp2	T	C	15: 9,139,428		probably null	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Tekt2	T	C	4: 126,324,317	E134G	probably damaging	Het
Ttll4	T	A	1: 74,681,816	I547K	probably damaging	Het
Vmn1r4	T	C	6: 56,956,784	I91T	probably damaging	Het
Vmn2r93	T	C	17: 18,316,587	S511P	probably damaging	Het
Vps50	T	C	6: 3,592,577		probably null	Het
Zeb2	T	G	2: 44,988,799	E1141A	probably damaging	Het
Zfp326	T	A	5: 105,911,493	Y373*	probably null	Het

Other mutations in Atp2c2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Atp2c2	APN	8	119745590	missense	probably benign
IGL01624:Atp2c2	APN	8	119757450	missense	probably benign	0.00
IGL02133:Atp2c2	APN	8	119754335	missense	probably benign	0.00
IGL02221:Atp2c2	APN	8	119744334	missense	probably damaging	1.00
IGL02606:Atp2c2	APN	8	119730274	missense	probably benign
IGL02657:Atp2c2	APN	8	119753032	missense	probably damaging	1.00
IGL02839:Atp2c2	APN	8	119749120	missense	possibly damaging	0.85
IGL03122:Atp2c2	APN	8	119742675	missense	possibly damaging	0.77
R0031:Atp2c2	UTSW	8	119749062	missense	probably benign	0.15
R0372:Atp2c2	UTSW	8	119757441	missense	probably benign
R0502:Atp2c2	UTSW	8	119734577	missense	probably null	0.99
R0503:Atp2c2	UTSW	8	119734577	missense	probably null	0.99
R0584:Atp2c2	UTSW	8	119738418	missense	probably benign	0.01
R1225:Atp2c2	UTSW	8	119735245	missense	probably damaging	1.00
R1580:Atp2c2	UTSW	8	119752987	missense	probably benign	0.00
R1620:Atp2c2	UTSW	8	119749126	missense	probably benign
R1638:Atp2c2	UTSW	8	119756003	missense	possibly damaging	0.82
R1745:Atp2c2	UTSW	8	119725094	missense	probably benign	0.02
R1746:Atp2c2	UTSW	8	119734443	unclassified	probably benign
R1907:Atp2c2	UTSW	8	119749876	splice site	probably benign
R2104:Atp2c2	UTSW	8	119749845	missense	probably benign
R2151:Atp2c2	UTSW	8	119756102	missense	probably benign
R2152:Atp2c2	UTSW	8	119756102	missense	probably benign
R2154:Atp2c2	UTSW	8	119756102	missense	probably benign
R2207:Atp2c2	UTSW	8	119748309	missense	probably damaging	1.00
R3874:Atp2c2	UTSW	8	119735296	missense	possibly damaging	0.74
R3912:Atp2c2	UTSW	8	119721276	missense	probably damaging	1.00
R4093:Atp2c2	UTSW	8	119749871	critical splice donor site	probably null
R4782:Atp2c2	UTSW	8	119749152	missense	probably damaging	0.97
R4801:Atp2c2	UTSW	8	119747687	missense	probably damaging	1.00
R4973:Atp2c2	UTSW	8	119754263	missense	probably benign	0.00
R5485:Atp2c2	UTSW	8	119753062	critical splice donor site	probably null
R5978:Atp2c2	UTSW	8	119749875	splice site	probably null
R6377:Atp2c2	UTSW	8	119726354	missense	probably benign	0.10
R6613:Atp2c2	UTSW	8	119756021	missense	probably damaging	0.99
R6765:Atp2c2	UTSW	8	119753017	missense	probably damaging	1.00
R6836:Atp2c2	UTSW	8	119734415	missense	probably damaging	1.00
R7220:Atp2c2	UTSW	8	119745561	missense	probably benign	0.00
R7238:Atp2c2	UTSW	8	119742421	missense	possibly damaging	0.73
R7373:Atp2c2	UTSW	8	119730252	missense	probably benign	0.02
R7438:Atp2c2	UTSW	8	119748197	missense	probably damaging	1.00
R7573:Atp2c2	UTSW	8	119751269	missense	probably damaging	1.00
R7677:Atp2c2	UTSW	8	119748176	missense	probably benign	0.00
R7737:Atp2c2	UTSW	8	119742395	missense	probably damaging	1.00
R7912:Atp2c2	UTSW	8	119730178	missense	possibly damaging	0.81
R8821:Atp2c2	UTSW	8	119749294	splice site	probably null
R8831:Atp2c2	UTSW	8	119749294	splice site	probably null
R9200:Atp2c2	UTSW	8	119748260	nonsense	probably null
R9211:Atp2c2	UTSW	8	119719293	missense	probably benign
R9246:Atp2c2	UTSW	8	119730250	missense	probably damaging	1.00
R9285:Atp2c2	UTSW	8	119738402	missense	probably benign	0.00
RF004:Atp2c2	UTSW	8	119752822	missense	probably damaging	1.00
RF012:Atp2c2	UTSW	8	119745514	missense	possibly damaging	0.91
Z1177:Atp2c2	UTSW	8	119734385	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TACAAAGTAGGGCTGTAAAGTCTGG -3'
(R):5'- GGACCATTGTTGACCATGGGTAAC -3'

Sequencing Primer
(F):5'- AAAGTCTGGAGAGTCTGCCTGC -3'
(R):5'- TTGACCATGGGTAACAATCTGG -3'

Posted On

2018-11-28