Incidental Mutation 'R6963:Asgr1'
ID 543337
Institutional Source Beutler Lab
Gene Symbol Asgr1
Ensembl Gene ENSMUSG00000020884
Gene Name asialoglycoprotein receptor 1
Synonyms Asgr-1, Asgr, ASGPR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6963 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 70054085-70057894 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 70055968 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018699] [ENSMUST00000092959] [ENSMUST00000108585] [ENSMUST00000123369] [ENSMUST00000146411]
AlphaFold P34927
Predicted Effect probably benign
Transcript: ENSMUST00000018699
SMART Domains Protein: ENSMUSP00000018699
Gene: ENSMUSG00000020884

DomainStartEndE-ValueType
Pfam:Lectin_N 6 143 1.1e-67 PFAM
CLECT 153 277 2.23e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092959
SMART Domains Protein: ENSMUSP00000090637
Gene: ENSMUSG00000020884

DomainStartEndE-ValueType
Pfam:Lectin_N 6 143 1.1e-67 PFAM
CLECT 153 277 2.23e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108585
SMART Domains Protein: ENSMUSP00000104226
Gene: ENSMUSG00000020884

DomainStartEndE-ValueType
Blast:GuKc 1 112 1e-24 BLAST
CLECT 124 248 2.23e-40 SMART
Predicted Effect probably null
Transcript: ENSMUST00000123369
SMART Domains Protein: ENSMUSP00000137469
Gene: ENSMUSG00000020884

DomainStartEndE-ValueType
Pfam:Lectin_N 1 43 2e-19 PFAM
CLECT 53 129 9.83e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146411
SMART Domains Protein: ENSMUSP00000121842
Gene: ENSMUSG00000020884

DomainStartEndE-ValueType
Pfam:Lectin_N 13 143 4.7e-55 PFAM
CLECT 153 277 2.23e-40 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the more abundant major subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this gene results in impaired hepatic clearance of asialoglycoproteins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,896,456 H196Y probably damaging Het
Abi3 G A 11: 95,832,741 probably benign Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Atp2c2 C T 8: 119,730,267 R203* probably null Het
Brms1 T A 19: 5,046,653 I121N probably damaging Het
Ccdc144b A G 3: 36,050,662 Y17H probably benign Het
Ccdc149 G A 5: 52,439,097 R58W probably damaging Het
D630003M21Rik T C 2: 158,200,308 E906G probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fry A G 5: 150,457,844 T444A probably benign Het
Ggn A G 7: 29,171,582 E142G probably damaging Het
Gm21994 A G 2: 150,255,345 C55R probably damaging Het
Gm5150 A G 3: 16,006,391 probably benign Het
Gp2 A G 7: 119,452,897 V198A probably benign Het
Gstm3 A G 3: 107,967,624 V104A probably benign Het
Idua A G 5: 108,679,775 K152E possibly damaging Het
Igsf21 A G 4: 140,027,730 S443P probably benign Het
Kdm5d C A Y: 937,975 Q925K probably benign Het
Ly6k G C 15: 74,798,582 P37R probably damaging Het
Mcm9 A G 10: 53,548,617 S626P probably damaging Het
Mcoln2 A G 3: 146,172,035 K137R probably damaging Het
Mctp2 T C 7: 72,228,056 N298S probably damaging Het
Mpp6 T C 6: 50,163,655 probably null Het
Myo10 T C 15: 25,734,063 I379T probably benign Het
Myo15b G T 11: 115,890,714 probably null Het
Nrg1 A G 8: 31,917,662 F181S probably benign Het
Olfr1449 C T 19: 12,935,638 A300V probably damaging Het
Pde9a G T 17: 31,443,887 V97L probably benign Het
Rfc5 T A 5: 117,387,866 probably null Het
Rnf145 T C 11: 44,564,277 S662P probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scfd2 A G 5: 74,482,209 V359A probably damaging Het
Skp2 T C 15: 9,139,428 probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tekt2 T C 4: 126,324,317 E134G probably damaging Het
Ttll4 T A 1: 74,681,816 I547K probably damaging Het
Vmn1r4 T C 6: 56,956,784 I91T probably damaging Het
Vmn2r93 T C 17: 18,316,587 S511P probably damaging Het
Vps50 T C 6: 3,592,577 probably null Het
Zeb2 T G 2: 44,988,799 E1141A probably damaging Het
Zfp326 T A 5: 105,911,493 Y373* probably null Het
Other mutations in Asgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02651:Asgr1 APN 11 70057130 missense possibly damaging 0.65
R1371:Asgr1 UTSW 11 70056097 missense probably benign 0.04
R1471:Asgr1 UTSW 11 70056093 missense possibly damaging 0.82
R1980:Asgr1 UTSW 11 70054946 missense probably damaging 1.00
R2186:Asgr1 UTSW 11 70056249 missense probably benign 0.02
R5757:Asgr1 UTSW 11 70054952 missense probably benign 0.01
R6037:Asgr1 UTSW 11 70056421 missense probably benign 0.00
R6037:Asgr1 UTSW 11 70056421 missense probably benign 0.00
R6478:Asgr1 UTSW 11 70056894 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTAGGGCAGGTCAAAGCTTTG -3'
(R):5'- TGTCTGTGTCCACCAACCAC -3'

Sequencing Primer
(F):5'- AGGTCAAAGCTTTGCACTTCTG -3'
(R):5'- GCTCACACACACCCGAAGTTG -3'
Posted On 2018-11-28