Incidental Mutation 'R6963:Abi3'
ID543338
Institutional Source Beutler Lab
Gene Symbol Abi3
Ensembl Gene ENSMUSG00000018381
Gene NameABI gene family, member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6963 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location95830074-95842476 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 95832741 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000054173] [ENSMUST00000059026] [ENSMUST00000107712] [ENSMUST00000133070] [ENSMUST00000150134]
Predicted Effect probably benign
Transcript: ENSMUST00000054173
SMART Domains Protein: ENSMUSP00000057858
Gene: ENSMUSG00000050860

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 27 264 6.9e-103 PFAM
Pfam:HAD 29 211 1.9e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000059026
AA Change: P359L
SMART Domains Protein: ENSMUSP00000061893
Gene: ENSMUSG00000018381
AA Change: P359L

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Abi_HHR 96 168 4.3e-31 PFAM
low complexity region 206 225 N/A INTRINSIC
low complexity region 233 252 N/A INTRINSIC
low complexity region 259 303 N/A INTRINSIC
SH3 312 367 1.41e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107712
SMART Domains Protein: ENSMUSP00000103340
Gene: ENSMUSG00000038811

DomainStartEndE-ValueType
G_gamma 5 69 6.71e-18 SMART
GGL 8 69 9.66e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133070
SMART Domains Protein: ENSMUSP00000122280
Gene: ENSMUSG00000075595

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000137645
AA Change: P238L
SMART Domains Protein: ENSMUSP00000119990
Gene: ENSMUSG00000018381
AA Change: P238L

DomainStartEndE-ValueType
Pfam:Abi_HHR 1 49 8.8e-14 PFAM
low complexity region 87 106 N/A INTRINSIC
low complexity region 114 133 N/A INTRINSIC
low complexity region 140 183 N/A INTRINSIC
SH3 192 244 2.89e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150134
Predicted Effect probably benign
Transcript: ENSMUST00000176538
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an adaptor protein family. Members of this family encode proteins containing a homeobox homology domain, proline rich region and Src-homology 3 (SH3) domain, and are components of the Abi/WAVE complex which regulates actin polymerization. The encoded protein inhibits ectopic metastasis of tumor cells as well as cell migration. This may be accomplished through interaction with p21-activated kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,896,456 H196Y probably damaging Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Asgr1 T C 11: 70,055,968 probably null Het
Atp2c2 C T 8: 119,730,267 R203* probably null Het
Brms1 T A 19: 5,046,653 I121N probably damaging Het
Ccdc144b A G 3: 36,050,662 Y17H probably benign Het
Ccdc149 G A 5: 52,439,097 R58W probably damaging Het
D630003M21Rik T C 2: 158,200,308 E906G probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fry A G 5: 150,457,844 T444A probably benign Het
Ggn A G 7: 29,171,582 E142G probably damaging Het
Gm21994 A G 2: 150,255,345 C55R probably damaging Het
Gm5150 A G 3: 16,006,391 probably benign Het
Gp2 A G 7: 119,452,897 V198A probably benign Het
Gstm3 A G 3: 107,967,624 V104A probably benign Het
Idua A G 5: 108,679,775 K152E possibly damaging Het
Igsf21 A G 4: 140,027,730 S443P probably benign Het
Kdm5d C A Y: 937,975 Q925K probably benign Het
Ly6k G C 15: 74,798,582 P37R probably damaging Het
Mcm9 A G 10: 53,548,617 S626P probably damaging Het
Mcoln2 A G 3: 146,172,035 K137R probably damaging Het
Mctp2 T C 7: 72,228,056 N298S probably damaging Het
Mpp6 T C 6: 50,163,655 probably null Het
Myo10 T C 15: 25,734,063 I379T probably benign Het
Myo15b G T 11: 115,890,714 probably null Het
Nrg1 A G 8: 31,917,662 F181S probably benign Het
Olfr1449 C T 19: 12,935,638 A300V probably damaging Het
Pde9a G T 17: 31,443,887 V97L probably benign Het
Rfc5 T A 5: 117,387,866 probably null Het
Rnf145 T C 11: 44,564,277 S662P probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scfd2 A G 5: 74,482,209 V359A probably damaging Het
Skp2 T C 15: 9,139,428 probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tekt2 T C 4: 126,324,317 E134G probably damaging Het
Ttll4 T A 1: 74,681,816 I547K probably damaging Het
Vmn1r4 T C 6: 56,956,784 I91T probably damaging Het
Vmn2r93 T C 17: 18,316,587 S511P probably damaging Het
Vps50 T C 6: 3,592,577 probably null Het
Zeb2 T G 2: 44,988,799 E1141A probably damaging Het
Zfp326 T A 5: 105,911,493 Y373* probably null Het
Other mutations in Abi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Abi3 APN 11 95835799 missense probably damaging 1.00
R0045:Abi3 UTSW 11 95832715 makesense probably null
R0626:Abi3 UTSW 11 95837111 missense probably benign 0.28
R0690:Abi3 UTSW 11 95833634 unclassified probably benign
R4653:Abi3 UTSW 11 95832811 missense probably benign 0.34
R5358:Abi3 UTSW 11 95842108 missense probably benign 0.21
R5881:Abi3 UTSW 11 95834387 missense probably damaging 1.00
R5881:Abi3 UTSW 11 95834388 missense probably damaging 1.00
R6020:Abi3 UTSW 11 95842025 nonsense probably null
R6036:Abi3 UTSW 11 95832858 unclassified probably benign
R6036:Abi3 UTSW 11 95832858 unclassified probably benign
R6130:Abi3 UTSW 11 95837095 missense probably damaging 1.00
R6388:Abi3 UTSW 11 95833638 critical splice donor site probably null
R7867:Abi3 UTSW 11 95834025 missense possibly damaging 0.85
R7950:Abi3 UTSW 11 95834025 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTCCCACTGCTGTATGGAGC -3'
(R):5'- TATTACAGCTCCTGTATCACCGTGG -3'

Sequencing Primer
(F):5'- TGCTGTATGGAGCAGGGAC -3'
(R):5'- TGCATGACCGAGGGGACAC -3'
Posted On2018-11-28