Incidental Mutation 'R6963:Brms1'
ID543345
Institutional Source Beutler Lab
Gene Symbol Brms1
Ensembl Gene ENSMUSG00000080268
Gene Namebreast cancer metastasis-suppressor 1
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_134155.1; MGI: 2388804

Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R6963 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5041404-5049917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5046653 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 121 (I121N)
Ref Sequence ENSEMBL: ENSMUSP00000112266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025818] [ENSMUST00000116567] [ENSMUST00000224178] [ENSMUST00000224288] [ENSMUST00000224363] [ENSMUST00000225427] [ENSMUST00000225799]
Predicted Effect probably benign
Transcript: ENSMUST00000025818
SMART Domains Protein: ENSMUSP00000025818
Gene: ENSMUSG00000024883

DomainStartEndE-ValueType
SH2 66 153 2.16e-5 SMART
low complexity region 241 264 N/A INTRINSIC
low complexity region 286 300 N/A INTRINSIC
low complexity region 307 341 N/A INTRINSIC
low complexity region 405 422 N/A INTRINSIC
low complexity region 432 454 N/A INTRINSIC
VPS9 478 596 2.29e-64 SMART
RA 613 694 1.14e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116567
AA Change: I121N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112266
Gene: ENSMUSG00000080268
AA Change: I121N

DomainStartEndE-ValueType
low complexity region 29 59 N/A INTRINSIC
Pfam:Sds3 60 209 5.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224178
Predicted Effect probably benign
Transcript: ENSMUST00000224288
Predicted Effect probably benign
Transcript: ENSMUST00000224363
Predicted Effect probably benign
Transcript: ENSMUST00000225427
Predicted Effect probably benign
Transcript: ENSMUST00000225799
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene reduces the metastatic potential, but not the tumorogenicity, of human breast cancer and melanoma cell lines. The protein encoded by this gene localizes primarily to the nucleus and is a component of the mSin3a family of histone deacetylase complexes (HDAC). The protein contains two coiled-coil motifs and several imperfect leucine zipper motifs. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(12) : Targeted(2) Gene trapped(10)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,896,456 H196Y probably damaging Het
Abi3 G A 11: 95,832,741 probably benign Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Asgr1 T C 11: 70,055,968 probably null Het
Atp2c2 C T 8: 119,730,267 R203* probably null Het
Ccdc144b A G 3: 36,050,662 Y17H probably benign Het
Ccdc149 G A 5: 52,439,097 R58W probably damaging Het
D630003M21Rik T C 2: 158,200,308 E906G probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fry A G 5: 150,457,844 T444A probably benign Het
Ggn A G 7: 29,171,582 E142G probably damaging Het
Gm21994 A G 2: 150,255,345 C55R probably damaging Het
Gm5150 A G 3: 16,006,391 probably benign Het
Gp2 A G 7: 119,452,897 V198A probably benign Het
Gstm3 A G 3: 107,967,624 V104A probably benign Het
Idua A G 5: 108,679,775 K152E possibly damaging Het
Igsf21 A G 4: 140,027,730 S443P probably benign Het
Kdm5d C A Y: 937,975 Q925K probably benign Het
Ly6k G C 15: 74,798,582 P37R probably damaging Het
Mcm9 A G 10: 53,548,617 S626P probably damaging Het
Mcoln2 A G 3: 146,172,035 K137R probably damaging Het
Mctp2 T C 7: 72,228,056 N298S probably damaging Het
Mpp6 T C 6: 50,163,655 probably null Het
Myo10 T C 15: 25,734,063 I379T probably benign Het
Myo15b G T 11: 115,890,714 probably null Het
Nrg1 A G 8: 31,917,662 F181S probably benign Het
Olfr1449 C T 19: 12,935,638 A300V probably damaging Het
Pde9a G T 17: 31,443,887 V97L probably benign Het
Rfc5 T A 5: 117,387,866 probably null Het
Rnf145 T C 11: 44,564,277 S662P probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scfd2 A G 5: 74,482,209 V359A probably damaging Het
Skp2 T C 15: 9,139,428 probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tekt2 T C 4: 126,324,317 E134G probably damaging Het
Ttll4 T A 1: 74,681,816 I547K probably damaging Het
Vmn1r4 T C 6: 56,956,784 I91T probably damaging Het
Vmn2r93 T C 17: 18,316,587 S511P probably damaging Het
Vps50 T C 6: 3,592,577 probably null Het
Zeb2 T G 2: 44,988,799 E1141A probably damaging Het
Zfp326 T A 5: 105,911,493 Y373* probably null Het
Other mutations in Brms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Brms1 APN 19 5049042 unclassified probably benign
IGL01391:Brms1 APN 19 5046695 missense possibly damaging 0.79
IGL02583:Brms1 APN 19 5046178 missense probably damaging 0.99
PIT4576001:Brms1 UTSW 19 5046201 missense probably damaging 1.00
R0054:Brms1 UTSW 19 5046699 nonsense probably null
R0054:Brms1 UTSW 19 5046699 nonsense probably null
R0670:Brms1 UTSW 19 5045971 missense probably damaging 1.00
R1757:Brms1 UTSW 19 5046407 missense probably damaging 1.00
R1962:Brms1 UTSW 19 5045999 missense probably damaging 0.97
R7096:Brms1 UTSW 19 5046680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAGAGCCCCAGAATATACG -3'
(R):5'- CCCAAGCAGTGTGTCATACAG -3'

Sequencing Primer
(F):5'- ATATACGGAACCTCTTGGCG -3'
(R):5'- GCAGTGTGTCATACAGCAGCATC -3'
Posted On2018-11-28