Incidental Mutation 'R6969:Fasl'
ID543351
Institutional Source Beutler Lab
Gene Symbol Fasl
Ensembl Gene ENSMUSG00000000817
Gene NameFas ligand (TNF superfamily, member 6)
SynonymsAPT1LG1, CD178, CD95L, Fas-L, Tnfsf6
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R6969 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location161780689-161788495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 161781675 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 37 (F37L)
Ref Sequence ENSEMBL: ENSMUSP00000141422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000834] [ENSMUST00000193648]
Predicted Effect probably damaging
Transcript: ENSMUST00000000834
AA Change: F247L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000834
Gene: ENSMUSG00000000817
AA Change: F247L

DomainStartEndE-ValueType
low complexity region 45 70 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
TNF 143 279 2.29e-54 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193648
AA Change: F37L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141422
Gene: ENSMUSG00000000817
AA Change: F37L

DomainStartEndE-ValueType
Pfam:TNF 1 69 2.3e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS. The FAS/FASLG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a spontaneous allele, knock-out allele, or allele producting only the soluble isoform exhibit premature death due to the development of systemic lupus erythematosus, autoimmune glomerulonephritis, hepatomegaly, lymphadenopathy, and hypergammaglobulinaemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,981,335 L800H unknown Het
Ap2b1 T A 11: 83,389,726 D788E probably damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgap9 G A 10: 127,326,643 E348K probably benign Het
B4galnt2 A T 11: 95,891,930 F19I probably benign Het
Bdp1 A T 13: 100,074,531 I551N probably damaging Het
Ceacam16 A G 7: 19,852,305 *427Q probably null Het
Chd9 A C 8: 90,978,914 Q260P probably benign Het
Col16a1 A T 4: 130,093,087 probably benign Het
Csmd1 A T 8: 17,216,789 N40K possibly damaging Het
Depdc5 T G 5: 32,983,860 V1368G probably damaging Het
Dnah7b C A 1: 46,358,238 P3943Q probably damaging Het
Dnttip2 A G 3: 122,282,492 Q691R probably damaging Het
Dusp10 T C 1: 184,068,888 L284P probably damaging Het
Efr3b A G 12: 3,968,624 V574A probably benign Het
Erc2 A T 14: 27,898,596 I60F probably damaging Het
Exoc2 A G 13: 30,911,178 V245A probably benign Het
Fat3 G A 9: 16,029,916 P1360S probably benign Het
Gm12666 A G 4: 92,191,589 I54T probably damaging Het
Gpsm1 C T 2: 26,340,543 P502S probably benign Het
Gtpbp10 C A 5: 5,555,331 G124V probably damaging Het
Insm2 T C 12: 55,600,178 C236R probably damaging Het
Irf2bpl A G 12: 86,882,694 Y402H possibly damaging Het
Irx6 A G 8: 92,677,330 E175G probably damaging Het
Kcnh8 C T 17: 52,877,943 R418* probably null Het
Kif3c G A 12: 3,366,114 R45Q probably benign Het
Lpin1 A G 12: 16,580,861 F12S probably damaging Het
Lrba A T 3: 86,619,590 T156S probably benign Het
Lrrc19 G T 4: 94,639,373 N200K probably benign Het
Lrrc7 G A 3: 158,156,913 H1296Y probably benign Het
Ltn1 A T 16: 87,415,690 F661Y probably damaging Het
Macf1 T C 4: 123,457,800 Y1893C probably benign Het
Mmd G C 11: 90,257,536 A15P probably damaging Het
Myh2 T C 11: 67,197,266 F1903L probably benign Het
Myom3 T C 4: 135,801,060 L1072P probably damaging Het
Olfr1350 G A 7: 6,570,321 C110Y probably damaging Het
Olfr1402 A T 3: 97,410,802 Y126* probably null Het
Olfr680-ps1 T C 7: 105,091,256 I128V probably benign Het
Olfr855 A T 9: 19,584,590 T18S possibly damaging Het
Patl2 A T 2: 122,128,929 V18D possibly damaging Het
Pkn1 T C 8: 83,683,426 S395G probably damaging Het
Ptprm A G 17: 66,912,418 I726T possibly damaging Het
Rab3gap2 T C 1: 185,236,012 L187P probably damaging Het
Ric1 A T 19: 29,585,782 E535V probably damaging Het
Ripor3 T C 2: 167,985,737 K598R probably benign Het
Rnf40 A G 7: 127,596,323 E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sbsn A G 7: 30,753,191 T544A probably benign Het
Scaf1 C A 7: 45,007,829 probably benign Het
Sec24a T C 11: 51,700,816 M1018V probably benign Het
Shmt1 C T 11: 60,804,327 A54T probably damaging Het
Slc39a14 C A 14: 70,308,826 V383F probably damaging Het
Slc5a2 A G 7: 128,272,077 T346A probably benign Het
Slco4a1 G A 2: 180,464,808 S261N probably benign Het
Smarcc1 C G 9: 110,196,320 S688R probably damaging Het
Sppl2b G A 10: 80,865,125 A314T probably damaging Het
Sptb A T 12: 76,608,007 V1513E probably damaging Het
Stx17 A T 4: 48,140,462 I56F probably damaging Het
Tbc1d9 A G 8: 83,241,542 Y424C probably damaging Het
Tgm3 A G 2: 130,042,029 K536E probably benign Het
Tti2 A G 8: 31,154,301 I309V possibly damaging Het
Tymp G A 15: 89,374,048 S334L probably benign Het
Unc13b T C 4: 43,263,538 F1587L possibly damaging Het
Vgf G T 5: 137,031,653 probably benign Het
Zfp59 T C 7: 27,853,497 S125P probably damaging Het
Zfp641 A T 15: 98,290,567 M144K possibly damaging Het
Zfp93 A T 7: 24,275,381 K264* probably null Het
Other mutations in Fasl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Fasl APN 1 161781838 missense probably damaging 0.99
IGL01510:Fasl APN 1 161781953 missense possibly damaging 0.50
riogrande UTSW 1 161788164 missense probably benign
riogrande2 UTSW 1 161787138 missense probably benign 0.00
ANU22:Fasl UTSW 1 161781838 missense probably damaging 0.99
R0012:Fasl UTSW 1 161788164 missense probably benign
R0454:Fasl UTSW 1 161787954 missense probably benign 0.16
R2167:Fasl UTSW 1 161787138 missense probably benign 0.00
R3794:Fasl UTSW 1 161781737 missense probably benign 0.16
R3911:Fasl UTSW 1 161788191 missense probably benign 0.10
R4082:Fasl UTSW 1 161781851 missense probably damaging 1.00
R4596:Fasl UTSW 1 161788269 missense probably benign 0.31
R4622:Fasl UTSW 1 161787134 missense probably benign 0.00
R6785:Fasl UTSW 1 161781835 missense probably benign 0.10
R7248:Fasl UTSW 1 161788191 missense possibly damaging 0.90
R7336:Fasl UTSW 1 161787988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGACCTGTTGGACCTTG -3'
(R):5'- CCAAAGTATACTTCCGGGGTC -3'

Sequencing Primer
(F):5'- ACCTTGCGGTCATGAGGTC -3'
(R):5'- GGGTCAGTCTTGCAACAACCAG -3'
Posted On2018-11-28