Incidental Mutation 'R6969:Gpsm1'
ID543354
Institutional Source Beutler Lab
Gene Symbol Gpsm1
Ensembl Gene ENSMUSG00000026930
Gene NameG-protein signalling modulator 1 (AGS3-like, C. elegans)
SynonymsAgs3, 1810037C22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6969 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location26315515-26348237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26340543 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 502 (P502S)
Ref Sequence ENSEMBL: ENSMUSP00000067964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066889] [ENSMUST00000066936] [ENSMUST00000078616] [ENSMUST00000114134] [ENSMUST00000127453]
Predicted Effect probably benign
Transcript: ENSMUST00000066889
AA Change: P502S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000067964
Gene: ENSMUSG00000026930
AA Change: P502S

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TPR 98 131 1.45e-1 SMART
TPR 138 171 7.06e-5 SMART
TPR 238 271 5.96e-3 SMART
TPR 278 311 1.47e-2 SMART
TPR 318 351 5.19e-3 SMART
TPR 358 391 1.33e0 SMART
GoLoco 525 547 7.38e-9 SMART
low complexity region 548 560 N/A INTRINSIC
GoLoco 578 600 4.24e-9 SMART
GoLoco 626 648 5.22e-9 SMART
GoLoco 660 682 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066936
AA Change: P470S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000065000
Gene: ENSMUSG00000026930
AA Change: P470S

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 493 515 7.38e-9 SMART
low complexity region 516 528 N/A INTRINSIC
GoLoco 546 568 4.24e-9 SMART
GoLoco 594 616 5.22e-9 SMART
GoLoco 628 650 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078616
SMART Domains Protein: ENSMUSP00000077686
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 433 455 7.38e-9 SMART
low complexity region 456 468 N/A INTRINSIC
GoLoco 486 508 4.24e-9 SMART
GoLoco 534 556 5.22e-9 SMART
GoLoco 568 590 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114134
SMART Domains Protein: ENSMUSP00000109769
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
GoLoco 56 78 7.38e-9 SMART
low complexity region 79 91 N/A INTRINSIC
GoLoco 109 131 4.24e-9 SMART
GoLoco 157 179 5.22e-9 SMART
GoLoco 191 213 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127453
Predicted Effect probably benign
Transcript: ENSMUST00000145884
AA Change: P293S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000115680
Gene: ENSMUSG00000026930
AA Change: P293S

DomainStartEndE-ValueType
Blast:TPR 22 68 1e-9 BLAST
Pfam:TPR_1 82 107 2.3e-4 PFAM
Pfam:TPR_12 82 147 7.9e-12 PFAM
Pfam:TPR_7 84 119 1.4e-5 PFAM
Pfam:TPR_2 122 147 6.2e-4 PFAM
Pfam:TPR_8 123 146 1.4e-2 PFAM
Blast:TPR 150 183 4e-15 BLAST
GoLoco 317 339 7.38e-9 SMART
low complexity region 340 352 N/A INTRINSIC
GoLoco 370 392 4.24e-9 SMART
GoLoco 418 440 5.22e-9 SMART
GoLoco 452 474 3.58e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] G-protein signaling modulators (GPSMs) play diverse functional roles through their interaction with G-protein subunits. This gene encodes a receptor-independent activator of G protein signaling, which is one of several factors that influence the basal activity of G-protein signaling systems. The protein contains seven tetratricopeptide repeats in its N-terminal half and four G-protein regulatory (GPR) motifs in its C-terminal half. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a lean phenotype, reduced fat mass, increased food consumption, increased nocturnal energy expenditure and altered blood pressure control mechanisms; surprisingly, their basal behavior and gross brain morphology remain normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,981,335 L800H unknown Het
Ap2b1 T A 11: 83,389,726 D788E probably damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgap9 G A 10: 127,326,643 E348K probably benign Het
B4galnt2 A T 11: 95,891,930 F19I probably benign Het
Bdp1 A T 13: 100,074,531 I551N probably damaging Het
Ceacam16 A G 7: 19,852,305 *427Q probably null Het
Chd9 A C 8: 90,978,914 Q260P probably benign Het
Col16a1 A T 4: 130,093,087 probably benign Het
Csmd1 A T 8: 17,216,789 N40K possibly damaging Het
Depdc5 T G 5: 32,983,860 V1368G probably damaging Het
Dnah7b C A 1: 46,358,238 P3943Q probably damaging Het
Dnttip2 A G 3: 122,282,492 Q691R probably damaging Het
Dusp10 T C 1: 184,068,888 L284P probably damaging Het
Efr3b A G 12: 3,968,624 V574A probably benign Het
Erc2 A T 14: 27,898,596 I60F probably damaging Het
Exoc2 A G 13: 30,911,178 V245A probably benign Het
Fasl G T 1: 161,781,675 F37L probably damaging Het
Fat3 G A 9: 16,029,916 P1360S probably benign Het
Gm12666 A G 4: 92,191,589 I54T probably damaging Het
Gtpbp10 C A 5: 5,555,331 G124V probably damaging Het
Insm2 T C 12: 55,600,178 C236R probably damaging Het
Irf2bpl A G 12: 86,882,694 Y402H possibly damaging Het
Irx6 A G 8: 92,677,330 E175G probably damaging Het
Kcnh8 C T 17: 52,877,943 R418* probably null Het
Kif3c G A 12: 3,366,114 R45Q probably benign Het
Lpin1 A G 12: 16,580,861 F12S probably damaging Het
Lrba A T 3: 86,619,590 T156S probably benign Het
Lrrc19 G T 4: 94,639,373 N200K probably benign Het
Lrrc7 G A 3: 158,156,913 H1296Y probably benign Het
Ltn1 A T 16: 87,415,690 F661Y probably damaging Het
Macf1 T C 4: 123,457,800 Y1893C probably benign Het
Mmd G C 11: 90,257,536 A15P probably damaging Het
Myh2 T C 11: 67,197,266 F1903L probably benign Het
Myom3 T C 4: 135,801,060 L1072P probably damaging Het
Olfr1350 G A 7: 6,570,321 C110Y probably damaging Het
Olfr1402 A T 3: 97,410,802 Y126* probably null Het
Olfr680-ps1 T C 7: 105,091,256 I128V probably benign Het
Olfr855 A T 9: 19,584,590 T18S possibly damaging Het
Patl2 A T 2: 122,128,929 V18D possibly damaging Het
Pkn1 T C 8: 83,683,426 S395G probably damaging Het
Ptprm A G 17: 66,912,418 I726T possibly damaging Het
Rab3gap2 T C 1: 185,236,012 L187P probably damaging Het
Ric1 A T 19: 29,585,782 E535V probably damaging Het
Ripor3 T C 2: 167,985,737 K598R probably benign Het
Rnf40 A G 7: 127,596,323 E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sbsn A G 7: 30,753,191 T544A probably benign Het
Scaf1 C A 7: 45,007,829 probably benign Het
Sec24a T C 11: 51,700,816 M1018V probably benign Het
Shmt1 C T 11: 60,804,327 A54T probably damaging Het
Slc39a14 C A 14: 70,308,826 V383F probably damaging Het
Slc5a2 A G 7: 128,272,077 T346A probably benign Het
Slco4a1 G A 2: 180,464,808 S261N probably benign Het
Smarcc1 C G 9: 110,196,320 S688R probably damaging Het
Sppl2b G A 10: 80,865,125 A314T probably damaging Het
Sptb A T 12: 76,608,007 V1513E probably damaging Het
Stx17 A T 4: 48,140,462 I56F probably damaging Het
Tbc1d9 A G 8: 83,241,542 Y424C probably damaging Het
Tgm3 A G 2: 130,042,029 K536E probably benign Het
Tti2 A G 8: 31,154,301 I309V possibly damaging Het
Tymp G A 15: 89,374,048 S334L probably benign Het
Unc13b T C 4: 43,263,538 F1587L possibly damaging Het
Vgf G T 5: 137,031,653 probably benign Het
Zfp59 T C 7: 27,853,497 S125P probably damaging Het
Zfp641 A T 15: 98,290,567 M144K possibly damaging Het
Zfp93 A T 7: 24,275,381 K264* probably null Het
Other mutations in Gpsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Gpsm1 APN 2 26346909 missense probably damaging 1.00
IGL01826:Gpsm1 APN 2 26326302 missense probably damaging 0.98
IGL02281:Gpsm1 APN 2 26339626 splice site probably benign
IGL02730:Gpsm1 APN 2 26325378 missense probably benign 0.13
IGL02740:Gpsm1 APN 2 26340573 missense probably benign 0.43
IGL02749:Gpsm1 APN 2 26339675 missense probably damaging 0.99
IGL02982:Gpsm1 APN 2 26324859 missense probably damaging 1.00
R1271:Gpsm1 UTSW 2 26344672 missense probably damaging 0.99
R1639:Gpsm1 UTSW 2 26345187 missense probably damaging 1.00
R1766:Gpsm1 UTSW 2 26325383 missense probably damaging 1.00
R1854:Gpsm1 UTSW 2 26344713 missense probably damaging 1.00
R2900:Gpsm1 UTSW 2 26345162 missense probably benign 0.00
R2994:Gpsm1 UTSW 2 26319831 unclassified probably benign
R2995:Gpsm1 UTSW 2 26319831 unclassified probably benign
R2996:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4227:Gpsm1 UTSW 2 26339626 splice site probably benign
R4391:Gpsm1 UTSW 2 26323997 missense probably damaging 1.00
R4413:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4461:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4469:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4659:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4786:Gpsm1 UTSW 2 26322481 missense probably benign 0.01
R5025:Gpsm1 UTSW 2 26319996 missense possibly damaging 0.90
R5057:Gpsm1 UTSW 2 26325357 missense probably damaging 0.96
R5171:Gpsm1 UTSW 2 26327464 intron probably benign
R5356:Gpsm1 UTSW 2 26340562 missense possibly damaging 0.73
R5417:Gpsm1 UTSW 2 26324033 critical splice donor site probably null
R5967:Gpsm1 UTSW 2 26340534 unclassified probably null
R6153:Gpsm1 UTSW 2 26325413 missense probably benign 0.14
R7006:Gpsm1 UTSW 2 26322560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCTAGCCCATGTCCAAC -3'
(R):5'- GTTATGAGCTCTGTGCCCTC -3'

Sequencing Primer
(F):5'- TAGCCCATGTCCAACCTGCC -3'
(R):5'- CTCAGAGTACCTGGATGCAC -3'
Posted On2018-11-28