Incidental Mutation 'R6969:Dnttip2'
ID 543361
Institutional Source Beutler Lab
Gene Symbol Dnttip2
Ensembl Gene ENSMUSG00000039756
Gene Name deoxynucleotidyltransferase, terminal, interacting protein 2
Synonyms 4930588M11Rik
MMRRC Submission 045079-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.969) question?
Stock # R6969 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 122068045-122078920 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122076141 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 691 (Q691R)
Ref Sequence ENSEMBL: ENSMUSP00000045043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035776]
AlphaFold Q8R2M2
Predicted Effect probably damaging
Transcript: ENSMUST00000035776
AA Change: Q691R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045043
Gene: ENSMUSG00000039756
AA Change: Q691R

DomainStartEndE-ValueType
low complexity region 125 143 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
coiled coil region 513 541 N/A INTRINSIC
low complexity region 550 565 N/A INTRINSIC
Pfam:Fcf2 639 733 3.4e-41 PFAM
low complexity region 748 756 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to be involved in chromatin remodeling and gene transcription. The encoded nuclear protein binds to and enhances the transcriptional activity of the estrogen receptor alpha, and also interacts with terminal deoxynucleotidyltransferase. The expression profile of this gene is a potential biomarker for chronic obstructive pulmonary disease. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,958,317 (GRCm39) L800H unknown Het
Ap2b1 T A 11: 83,280,552 (GRCm39) D788E probably damaging Het
Arfgef1 G T 1: 10,223,904 (GRCm39) Q1465K probably damaging Het
Arfgef1 T C 1: 10,223,903 (GRCm39) Q1465R probably damaging Het
Arhgap9 G A 10: 127,162,512 (GRCm39) E348K probably benign Het
B4galnt2 A T 11: 95,782,756 (GRCm39) F19I probably benign Het
Bdp1 A T 13: 100,211,039 (GRCm39) I551N probably damaging Het
Ceacam16 A G 7: 19,586,230 (GRCm39) *427Q probably null Het
Chd9 A C 8: 91,705,542 (GRCm39) Q260P probably benign Het
Col16a1 A T 4: 129,986,880 (GRCm39) probably benign Het
Csmd1 A T 8: 17,266,805 (GRCm39) N40K possibly damaging Het
Depdc5 T G 5: 33,141,204 (GRCm39) V1368G probably damaging Het
Dnah7b C A 1: 46,397,398 (GRCm39) P3943Q probably damaging Het
Dusp10 T C 1: 183,801,085 (GRCm39) L284P probably damaging Het
Efr3b A G 12: 4,018,624 (GRCm39) V574A probably benign Het
Erc2 A T 14: 27,620,553 (GRCm39) I60F probably damaging Het
Exoc2 A G 13: 31,095,161 (GRCm39) V245A probably benign Het
Fasl G T 1: 161,609,244 (GRCm39) F37L probably damaging Het
Fat3 G A 9: 15,941,212 (GRCm39) P1360S probably benign Het
Gpsm1 C T 2: 26,230,555 (GRCm39) P502S probably benign Het
Gtpbp10 C A 5: 5,605,331 (GRCm39) G124V probably damaging Het
Insm2 T C 12: 55,646,963 (GRCm39) C236R probably damaging Het
Irf2bpl A G 12: 86,929,468 (GRCm39) Y402H possibly damaging Het
Irx6 A G 8: 93,403,958 (GRCm39) E175G probably damaging Het
Kcnh8 C T 17: 53,184,971 (GRCm39) R418* probably null Het
Kif3c G A 12: 3,416,114 (GRCm39) R45Q probably benign Het
Larp7-ps A G 4: 92,079,826 (GRCm39) I54T probably damaging Het
Lpin1 A G 12: 16,630,862 (GRCm39) F12S probably damaging Het
Lrba A T 3: 86,526,897 (GRCm39) T156S probably benign Het
Lrrc19 G T 4: 94,527,610 (GRCm39) N200K probably benign Het
Lrrc7 G A 3: 157,862,550 (GRCm39) H1296Y probably benign Het
Ltn1 A T 16: 87,212,578 (GRCm39) F661Y probably damaging Het
Macf1 T C 4: 123,351,593 (GRCm39) Y1893C probably benign Het
Mmd G C 11: 90,148,362 (GRCm39) A15P probably damaging Het
Myh2 T C 11: 67,088,092 (GRCm39) F1903L probably benign Het
Myom3 T C 4: 135,528,371 (GRCm39) L1072P probably damaging Het
Or13l2 A T 3: 97,318,118 (GRCm39) Y126* probably null Het
Or56a41 T C 7: 104,740,463 (GRCm39) I128V probably benign Het
Or5bw2 G A 7: 6,573,320 (GRCm39) C110Y probably damaging Het
Or7g35 A T 9: 19,495,886 (GRCm39) T18S possibly damaging Het
Patl2 A T 2: 121,959,410 (GRCm39) V18D possibly damaging Het
Pkn1 T C 8: 84,410,055 (GRCm39) S395G probably damaging Het
Ptprm A G 17: 67,219,413 (GRCm39) I726T possibly damaging Het
Rab3gap2 T C 1: 184,968,209 (GRCm39) L187P probably damaging Het
Ric1 A T 19: 29,563,182 (GRCm39) E535V probably damaging Het
Ripor3 T C 2: 167,827,657 (GRCm39) K598R probably benign Het
Rnf40 A G 7: 127,195,495 (GRCm39) E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sbsn A G 7: 30,452,616 (GRCm39) T544A probably benign Het
Scaf1 C A 7: 44,657,253 (GRCm39) probably benign Het
Sec24a T C 11: 51,591,643 (GRCm39) M1018V probably benign Het
Shmt1 C T 11: 60,695,153 (GRCm39) A54T probably damaging Het
Slc39a14 C A 14: 70,546,275 (GRCm39) V383F probably damaging Het
Slc5a2 A G 7: 127,871,249 (GRCm39) T346A probably benign Het
Slco4a1 G A 2: 180,106,601 (GRCm39) S261N probably benign Het
Smarcc1 C G 9: 110,025,388 (GRCm39) S688R probably damaging Het
Sppl2b G A 10: 80,700,959 (GRCm39) A314T probably damaging Het
Sptb A T 12: 76,654,781 (GRCm39) V1513E probably damaging Het
Stx17 A T 4: 48,140,462 (GRCm39) I56F probably damaging Het
Tbc1d9 A G 8: 83,968,171 (GRCm39) Y424C probably damaging Het
Tgm3 A G 2: 129,883,949 (GRCm39) K536E probably benign Het
Tti2 A G 8: 31,644,329 (GRCm39) I309V possibly damaging Het
Tymp G A 15: 89,258,251 (GRCm39) S334L probably benign Het
Unc13b T C 4: 43,263,538 (GRCm39) F1587L possibly damaging Het
Vgf G T 5: 137,060,507 (GRCm39) probably benign Het
Zfp59 T C 7: 27,552,922 (GRCm39) S125P probably damaging Het
Zfp641 A T 15: 98,188,448 (GRCm39) M144K possibly damaging Het
Zfp93 A T 7: 23,974,806 (GRCm39) K264* probably null Het
Other mutations in Dnttip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Dnttip2 APN 3 122,078,148 (GRCm39) missense probably damaging 1.00
IGL00921:Dnttip2 APN 3 122,068,939 (GRCm39) missense probably benign 0.03
IGL01120:Dnttip2 APN 3 122,072,386 (GRCm39) splice site probably benign
IGL01341:Dnttip2 APN 3 122,070,261 (GRCm39) missense probably damaging 1.00
IGL01636:Dnttip2 APN 3 122,076,123 (GRCm39) missense possibly damaging 0.95
IGL01988:Dnttip2 APN 3 122,069,944 (GRCm39) missense probably benign 0.05
IGL02096:Dnttip2 APN 3 122,078,062 (GRCm39) missense possibly damaging 0.51
IGL02216:Dnttip2 APN 3 122,069,910 (GRCm39) missense probably benign 0.01
IGL03234:Dnttip2 APN 3 122,076,087 (GRCm39) missense probably damaging 1.00
Abyss UTSW 3 122,069,870 (GRCm39) missense probably damaging 0.99
Chasm UTSW 3 122,069,457 (GRCm39) missense probably damaging 1.00
R0089:Dnttip2 UTSW 3 122,069,111 (GRCm39) missense possibly damaging 0.59
R0102:Dnttip2 UTSW 3 122,069,452 (GRCm39) missense probably benign 0.00
R0102:Dnttip2 UTSW 3 122,069,452 (GRCm39) missense probably benign 0.00
R0195:Dnttip2 UTSW 3 122,069,810 (GRCm39) missense probably benign 0.02
R1103:Dnttip2 UTSW 3 122,070,071 (GRCm39) missense probably benign 0.02
R1733:Dnttip2 UTSW 3 122,070,397 (GRCm39) missense probably benign 0.25
R1759:Dnttip2 UTSW 3 122,069,798 (GRCm39) missense probably benign 0.21
R2019:Dnttip2 UTSW 3 122,074,393 (GRCm39) missense possibly damaging 0.93
R2022:Dnttip2 UTSW 3 122,069,870 (GRCm39) missense probably damaging 1.00
R2415:Dnttip2 UTSW 3 122,070,186 (GRCm39) missense probably damaging 1.00
R3913:Dnttip2 UTSW 3 122,069,040 (GRCm39) missense possibly damaging 0.68
R4194:Dnttip2 UTSW 3 122,074,410 (GRCm39) missense probably damaging 1.00
R4367:Dnttip2 UTSW 3 122,070,146 (GRCm39) missense probably damaging 1.00
R4871:Dnttip2 UTSW 3 122,078,750 (GRCm39) missense probably damaging 1.00
R4888:Dnttip2 UTSW 3 122,070,241 (GRCm39) missense probably damaging 1.00
R5082:Dnttip2 UTSW 3 122,069,590 (GRCm39) missense probably damaging 0.98
R5436:Dnttip2 UTSW 3 122,072,418 (GRCm39) missense probably damaging 1.00
R5483:Dnttip2 UTSW 3 122,070,446 (GRCm39) missense probably damaging 0.97
R5933:Dnttip2 UTSW 3 122,069,217 (GRCm39) missense probably benign 0.07
R5966:Dnttip2 UTSW 3 122,078,817 (GRCm39) utr 3 prime probably benign
R6171:Dnttip2 UTSW 3 122,072,511 (GRCm39) missense probably damaging 0.99
R6251:Dnttip2 UTSW 3 122,068,905 (GRCm39) missense probably benign 0.14
R6286:Dnttip2 UTSW 3 122,078,049 (GRCm39) missense probably damaging 1.00
R6512:Dnttip2 UTSW 3 122,069,172 (GRCm39) missense possibly damaging 0.67
R6519:Dnttip2 UTSW 3 122,069,120 (GRCm39) missense probably benign 0.05
R6670:Dnttip2 UTSW 3 122,069,870 (GRCm39) missense probably damaging 0.99
R6833:Dnttip2 UTSW 3 122,070,452 (GRCm39) missense probably damaging 0.99
R6870:Dnttip2 UTSW 3 122,069,457 (GRCm39) missense probably damaging 1.00
R7038:Dnttip2 UTSW 3 122,070,181 (GRCm39) nonsense probably null
R7233:Dnttip2 UTSW 3 122,070,039 (GRCm39) missense probably benign 0.26
R7423:Dnttip2 UTSW 3 122,069,175 (GRCm39) missense probably benign
R7591:Dnttip2 UTSW 3 122,070,117 (GRCm39) nonsense probably null
R7765:Dnttip2 UTSW 3 122,069,594 (GRCm39) missense probably benign 0.09
R7842:Dnttip2 UTSW 3 122,069,990 (GRCm39) missense probably benign 0.03
R7899:Dnttip2 UTSW 3 122,076,018 (GRCm39) missense probably damaging 1.00
R8408:Dnttip2 UTSW 3 122,070,351 (GRCm39) missense probably damaging 1.00
R8753:Dnttip2 UTSW 3 122,074,398 (GRCm39) missense probably damaging 0.98
R9165:Dnttip2 UTSW 3 122,070,355 (GRCm39) missense probably benign
Z1189:Dnttip2 UTSW 3 122,070,305 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATAACCCAGCAGGCAGTGTG -3'
(R):5'- GGTACCCATTATAAAACGGTGGC -3'

Sequencing Primer
(F):5'- TCTCACAGAGGGTCAGCTTG -3'
(R):5'- CCCATTATAAAACGGTGGCTATGTG -3'
Posted On 2018-11-28