Incidental Mutation 'R6969:Col16a1'
ID 543368
Institutional Source Beutler Lab
Gene Symbol Col16a1
Ensembl Gene ENSMUSG00000040690
Gene Name collagen, type XVI, alpha 1
Synonyms 2700007F12Rik, A530052M23Rik, [a]1 (XVI) collagen
MMRRC Submission 045079-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R6969 (G1)
Quality Score 180.009
Status Not validated
Chromosome 4
Chromosomal Location 129941638-129993070 bp(+) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) A to T at 129986880 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044565] [ENSMUST00000143432] [ENSMUST00000143577]
AlphaFold Q8BLX7
Predicted Effect unknown
Transcript: ENSMUST00000044565
AA Change: D1291V
SMART Domains Protein: ENSMUSP00000035802
Gene: ENSMUSG00000040690
AA Change: D1291V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 50 231 1.07e-68 SMART
internal_repeat_4 330 355 2.35e-7 PROSPERO
Pfam:Collagen 372 431 1.6e-8 PFAM
low complexity region 441 507 N/A INTRINSIC
low complexity region 525 542 N/A INTRINSIC
internal_repeat_2 546 562 2.68e-9 PROSPERO
internal_repeat_1 547 580 9.92e-10 PROSPERO
Pfam:Collagen 584 646 1.5e-9 PFAM
internal_repeat_5 662 689 6.35e-7 PROSPERO
internal_repeat_3 662 731 1.96e-8 PROSPERO
internal_repeat_7 679 695 2.06e-5 PROSPERO
internal_repeat_6 682 730 7.63e-6 PROSPERO
internal_repeat_1 685 742 9.92e-10 PROSPERO
Pfam:Collagen 796 850 3.4e-9 PFAM
internal_repeat_5 859 889 6.35e-7 PROSPERO
low complexity region 891 922 N/A INTRINSIC
low complexity region 990 1000 N/A INTRINSIC
Pfam:Collagen 1001 1064 1.4e-10 PFAM
low complexity region 1090 1112 N/A INTRINSIC
internal_repeat_7 1114 1130 2.06e-5 PROSPERO
low complexity region 1132 1162 N/A INTRINSIC
low complexity region 1171 1222 N/A INTRINSIC
low complexity region 1230 1282 N/A INTRINSIC
internal_repeat_2 1283 1299 2.68e-9 PROSPERO
internal_repeat_6 1287 1335 7.63e-6 PROSPERO
Pfam:Collagen 1350 1411 1.8e-9 PFAM
Pfam:Collagen 1446 1503 5.3e-10 PFAM
low complexity region 1505 1525 N/A INTRINSIC
low complexity region 1528 1549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143432
SMART Domains Protein: ENSMUSP00000120384
Gene: ENSMUSG00000040690

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 50 231 1.07e-68 SMART
internal_repeat_1 330 353 5.41e-8 PROSPERO
Pfam:Collagen 372 426 2.1e-9 PFAM
low complexity region 441 507 N/A INTRINSIC
low complexity region 525 542 N/A INTRINSIC
internal_repeat_1 546 569 5.41e-8 PROSPERO
internal_repeat_2 547 580 5.41e-8 PROSPERO
Pfam:Collagen 584 646 2.7e-10 PFAM
Pfam:Collagen 659 736 8.6e-8 PFAM
Pfam:Collagen 745 797 1.6e-7 PFAM
Pfam:Collagen 796 850 5.9e-10 PFAM
Pfam:Collagen 848 923 1.6e-7 PFAM
low complexity region 974 984 N/A INTRINSIC
Pfam:Collagen 987 1045 1e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000143577
AA Change: D994V
SMART Domains Protein: ENSMUSP00000120339
Gene: ENSMUSG00000040690
AA Change: D994V

DomainStartEndE-ValueType
internal_repeat_7 1 43 5.7e-5 PROSPERO
Pfam:Collagen 57 112 2e-9 PFAM
low complexity region 126 192 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
internal_repeat_2 231 247 1.5e-10 PROSPERO
internal_repeat_1 232 265 5.16e-11 PROSPERO
Pfam:Collagen 269 331 3.4e-10 PFAM
Pfam:Collagen 360 421 7e-11 PFAM
Pfam:Collagen 430 482 1.9e-7 PFAM
Pfam:Collagen 481 535 7.8e-10 PFAM
Pfam:Collagen 560 623 1.4e-7 PFAM
internal_repeat_9 640 665 9.73e-5 PROSPERO
low complexity region 675 685 N/A INTRINSIC
Pfam:Collagen 686 747 2.5e-11 PFAM
Pfam:Collagen 730 802 5.2e-9 PFAM
Pfam:Collagen 783 860 9.2e-9 PFAM
low complexity region 871 922 N/A INTRINSIC
low complexity region 930 985 N/A INTRINSIC
internal_repeat_2 986 1002 1.5e-10 PROSPERO
internal_repeat_5 990 1038 7.88e-7 PROSPERO
low complexity region 1041 1110 N/A INTRINSIC
Pfam:Collagen 1149 1205 1.8e-10 PFAM
Pfam:Collagen 1203 1260 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XVI collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. High levels of type XVI collagen have been found in fibroblasts and keratinocytes, and in smooth muscle and amnion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,958,317 (GRCm39) L800H unknown Het
Ap2b1 T A 11: 83,280,552 (GRCm39) D788E probably damaging Het
Arfgef1 G T 1: 10,223,904 (GRCm39) Q1465K probably damaging Het
Arfgef1 T C 1: 10,223,903 (GRCm39) Q1465R probably damaging Het
Arhgap9 G A 10: 127,162,512 (GRCm39) E348K probably benign Het
B4galnt2 A T 11: 95,782,756 (GRCm39) F19I probably benign Het
Bdp1 A T 13: 100,211,039 (GRCm39) I551N probably damaging Het
Ceacam16 A G 7: 19,586,230 (GRCm39) *427Q probably null Het
Chd9 A C 8: 91,705,542 (GRCm39) Q260P probably benign Het
Csmd1 A T 8: 17,266,805 (GRCm39) N40K possibly damaging Het
Depdc5 T G 5: 33,141,204 (GRCm39) V1368G probably damaging Het
Dnah7b C A 1: 46,397,398 (GRCm39) P3943Q probably damaging Het
Dnttip2 A G 3: 122,076,141 (GRCm39) Q691R probably damaging Het
Dusp10 T C 1: 183,801,085 (GRCm39) L284P probably damaging Het
Efr3b A G 12: 4,018,624 (GRCm39) V574A probably benign Het
Erc2 A T 14: 27,620,553 (GRCm39) I60F probably damaging Het
Exoc2 A G 13: 31,095,161 (GRCm39) V245A probably benign Het
Fasl G T 1: 161,609,244 (GRCm39) F37L probably damaging Het
Fat3 G A 9: 15,941,212 (GRCm39) P1360S probably benign Het
Gpsm1 C T 2: 26,230,555 (GRCm39) P502S probably benign Het
Gtpbp10 C A 5: 5,605,331 (GRCm39) G124V probably damaging Het
Insm2 T C 12: 55,646,963 (GRCm39) C236R probably damaging Het
Irf2bpl A G 12: 86,929,468 (GRCm39) Y402H possibly damaging Het
Irx6 A G 8: 93,403,958 (GRCm39) E175G probably damaging Het
Kcnh8 C T 17: 53,184,971 (GRCm39) R418* probably null Het
Kif3c G A 12: 3,416,114 (GRCm39) R45Q probably benign Het
Larp7-ps A G 4: 92,079,826 (GRCm39) I54T probably damaging Het
Lpin1 A G 12: 16,630,862 (GRCm39) F12S probably damaging Het
Lrba A T 3: 86,526,897 (GRCm39) T156S probably benign Het
Lrrc19 G T 4: 94,527,610 (GRCm39) N200K probably benign Het
Lrrc7 G A 3: 157,862,550 (GRCm39) H1296Y probably benign Het
Ltn1 A T 16: 87,212,578 (GRCm39) F661Y probably damaging Het
Macf1 T C 4: 123,351,593 (GRCm39) Y1893C probably benign Het
Mmd G C 11: 90,148,362 (GRCm39) A15P probably damaging Het
Myh2 T C 11: 67,088,092 (GRCm39) F1903L probably benign Het
Myom3 T C 4: 135,528,371 (GRCm39) L1072P probably damaging Het
Or13l2 A T 3: 97,318,118 (GRCm39) Y126* probably null Het
Or56a41 T C 7: 104,740,463 (GRCm39) I128V probably benign Het
Or5bw2 G A 7: 6,573,320 (GRCm39) C110Y probably damaging Het
Or7g35 A T 9: 19,495,886 (GRCm39) T18S possibly damaging Het
Patl2 A T 2: 121,959,410 (GRCm39) V18D possibly damaging Het
Pkn1 T C 8: 84,410,055 (GRCm39) S395G probably damaging Het
Ptprm A G 17: 67,219,413 (GRCm39) I726T possibly damaging Het
Rab3gap2 T C 1: 184,968,209 (GRCm39) L187P probably damaging Het
Ric1 A T 19: 29,563,182 (GRCm39) E535V probably damaging Het
Ripor3 T C 2: 167,827,657 (GRCm39) K598R probably benign Het
Rnf40 A G 7: 127,195,495 (GRCm39) E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sbsn A G 7: 30,452,616 (GRCm39) T544A probably benign Het
Scaf1 C A 7: 44,657,253 (GRCm39) probably benign Het
Sec24a T C 11: 51,591,643 (GRCm39) M1018V probably benign Het
Shmt1 C T 11: 60,695,153 (GRCm39) A54T probably damaging Het
Slc39a14 C A 14: 70,546,275 (GRCm39) V383F probably damaging Het
Slc5a2 A G 7: 127,871,249 (GRCm39) T346A probably benign Het
Slco4a1 G A 2: 180,106,601 (GRCm39) S261N probably benign Het
Smarcc1 C G 9: 110,025,388 (GRCm39) S688R probably damaging Het
Sppl2b G A 10: 80,700,959 (GRCm39) A314T probably damaging Het
Sptb A T 12: 76,654,781 (GRCm39) V1513E probably damaging Het
Stx17 A T 4: 48,140,462 (GRCm39) I56F probably damaging Het
Tbc1d9 A G 8: 83,968,171 (GRCm39) Y424C probably damaging Het
Tgm3 A G 2: 129,883,949 (GRCm39) K536E probably benign Het
Tti2 A G 8: 31,644,329 (GRCm39) I309V possibly damaging Het
Tymp G A 15: 89,258,251 (GRCm39) S334L probably benign Het
Unc13b T C 4: 43,263,538 (GRCm39) F1587L possibly damaging Het
Vgf G T 5: 137,060,507 (GRCm39) probably benign Het
Zfp59 T C 7: 27,552,922 (GRCm39) S125P probably damaging Het
Zfp641 A T 15: 98,188,448 (GRCm39) M144K possibly damaging Het
Zfp93 A T 7: 23,974,806 (GRCm39) K264* probably null Het
Other mutations in Col16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Col16a1 APN 4 129,988,345 (GRCm39) splice site probably null
IGL00885:Col16a1 APN 4 129,990,703 (GRCm39) missense probably damaging 1.00
IGL01931:Col16a1 APN 4 129,966,634 (GRCm39) missense possibly damaging 0.47
IGL02142:Col16a1 APN 4 129,945,440 (GRCm39) splice site probably null
IGL02307:Col16a1 APN 4 129,952,802 (GRCm39) missense probably damaging 1.00
IGL02731:Col16a1 APN 4 129,947,323 (GRCm39) unclassified probably benign
IGL02742:Col16a1 APN 4 129,955,172 (GRCm39) unclassified probably benign
PIT4520001:Col16a1 UTSW 4 129,945,456 (GRCm39) missense unknown
R0127:Col16a1 UTSW 4 129,946,650 (GRCm39) missense probably damaging 1.00
R0131:Col16a1 UTSW 4 129,960,889 (GRCm39) missense unknown
R0131:Col16a1 UTSW 4 129,960,889 (GRCm39) missense unknown
R0132:Col16a1 UTSW 4 129,960,889 (GRCm39) missense unknown
R0299:Col16a1 UTSW 4 129,952,111 (GRCm39) frame shift probably null
R0355:Col16a1 UTSW 4 129,952,206 (GRCm39) splice site probably benign
R0395:Col16a1 UTSW 4 129,966,902 (GRCm39) missense probably damaging 1.00
R0485:Col16a1 UTSW 4 129,984,290 (GRCm39) splice site probably benign
R0573:Col16a1 UTSW 4 129,962,268 (GRCm39) splice site probably benign
R1274:Col16a1 UTSW 4 129,991,594 (GRCm39) missense probably damaging 0.98
R1619:Col16a1 UTSW 4 129,992,733 (GRCm39) missense probably damaging 1.00
R1759:Col16a1 UTSW 4 129,978,062 (GRCm39) missense probably damaging 1.00
R1832:Col16a1 UTSW 4 129,970,850 (GRCm39) splice site probably null
R1861:Col16a1 UTSW 4 129,955,517 (GRCm39) unclassified probably benign
R1862:Col16a1 UTSW 4 129,986,575 (GRCm39) critical splice donor site probably null
R1981:Col16a1 UTSW 4 129,959,236 (GRCm39) missense unknown
R2265:Col16a1 UTSW 4 129,946,711 (GRCm39) missense probably benign 0.02
R2269:Col16a1 UTSW 4 129,946,711 (GRCm39) missense probably benign 0.02
R2291:Col16a1 UTSW 4 129,960,833 (GRCm39) missense unknown
R3176:Col16a1 UTSW 4 129,951,792 (GRCm39) missense probably damaging 0.99
R3276:Col16a1 UTSW 4 129,951,792 (GRCm39) missense probably damaging 0.99
R3552:Col16a1 UTSW 4 129,970,834 (GRCm39) missense probably benign 0.10
R4049:Col16a1 UTSW 4 129,962,545 (GRCm39) missense probably damaging 1.00
R4241:Col16a1 UTSW 4 129,992,843 (GRCm39) missense probably damaging 0.98
R4327:Col16a1 UTSW 4 129,988,344 (GRCm39) critical splice donor site probably null
R4591:Col16a1 UTSW 4 129,955,592 (GRCm39) splice site probably null
R4664:Col16a1 UTSW 4 129,955,883 (GRCm39) unclassified probably benign
R4803:Col16a1 UTSW 4 129,948,901 (GRCm39) unclassified probably benign
R4925:Col16a1 UTSW 4 129,947,969 (GRCm39) missense probably damaging 1.00
R4961:Col16a1 UTSW 4 129,948,272 (GRCm39) splice site probably null
R5016:Col16a1 UTSW 4 129,972,988 (GRCm39) missense probably benign 0.31
R5027:Col16a1 UTSW 4 129,972,988 (GRCm39) missense probably benign 0.31
R5085:Col16a1 UTSW 4 129,947,964 (GRCm39) missense probably damaging 1.00
R5088:Col16a1 UTSW 4 129,972,988 (GRCm39) missense probably benign 0.31
R5089:Col16a1 UTSW 4 129,972,988 (GRCm39) missense probably benign 0.31
R5408:Col16a1 UTSW 4 129,986,898 (GRCm39) utr 3 prime probably benign
R5472:Col16a1 UTSW 4 129,986,564 (GRCm39) utr 3 prime probably benign
R5564:Col16a1 UTSW 4 129,947,151 (GRCm39) missense probably damaging 1.00
R5597:Col16a1 UTSW 4 129,952,097 (GRCm39) missense probably damaging 1.00
R5703:Col16a1 UTSW 4 129,947,092 (GRCm39) missense probably damaging 0.96
R6054:Col16a1 UTSW 4 129,955,515 (GRCm39) unclassified probably benign
R6226:Col16a1 UTSW 4 129,948,882 (GRCm39) unclassified probably benign
R6362:Col16a1 UTSW 4 129,959,983 (GRCm39) missense unknown
R6448:Col16a1 UTSW 4 129,952,781 (GRCm39) missense probably damaging 1.00
R6449:Col16a1 UTSW 4 129,960,486 (GRCm39) missense unknown
R6502:Col16a1 UTSW 4 129,949,787 (GRCm39) missense probably damaging 1.00
R6949:Col16a1 UTSW 4 129,953,116 (GRCm39) missense probably damaging 1.00
R7086:Col16a1 UTSW 4 129,946,773 (GRCm39) splice site probably null
R7375:Col16a1 UTSW 4 129,959,294 (GRCm39) missense unknown
R7703:Col16a1 UTSW 4 129,990,295 (GRCm39) missense unknown
R7808:Col16a1 UTSW 4 129,967,057 (GRCm39) missense unknown
R7904:Col16a1 UTSW 4 129,948,001 (GRCm39) nonsense probably null
R7936:Col16a1 UTSW 4 129,990,664 (GRCm39) critical splice acceptor site probably null
R7981:Col16a1 UTSW 4 129,980,347 (GRCm39) critical splice donor site probably null
R8161:Col16a1 UTSW 4 129,954,262 (GRCm39) missense unknown
R8178:Col16a1 UTSW 4 129,947,270 (GRCm39) missense unknown
R8266:Col16a1 UTSW 4 129,959,224 (GRCm39) missense unknown
R8312:Col16a1 UTSW 4 129,948,244 (GRCm39) missense unknown
R8714:Col16a1 UTSW 4 129,947,961 (GRCm39) missense unknown
R9011:Col16a1 UTSW 4 129,946,652 (GRCm39) missense unknown
R9088:Col16a1 UTSW 4 129,971,016 (GRCm39) missense unknown
RF014:Col16a1 UTSW 4 129,986,860 (GRCm39) critical splice acceptor site probably benign
Z1176:Col16a1 UTSW 4 129,966,671 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCTTCTGGGATAAGGCAAAGGG -3'
(R):5'- AGCTTACAGGGCTCATCTATCTG -3'

Sequencing Primer
(F):5'- GCTTGGGCCATCCTAGGG -3'
(R):5'- GATGCTGCTATGCTAACAGC -3'
Posted On 2018-11-28