Incidental Mutation 'R6969:Gtpbp10'
ID543370
Institutional Source Beutler Lab
Gene Symbol Gtpbp10
Ensembl Gene ENSMUSG00000040464
Gene NameGTP-binding protein 10 (putative)
Synonyms4930545J22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6969 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location5537454-5559538 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5555331 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 124 (G124V)
Ref Sequence ENSEMBL: ENSMUSP00000111101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088842] [ENSMUST00000115441] [ENSMUST00000119521] [ENSMUST00000147244] [ENSMUST00000198799]
Predicted Effect probably benign
Transcript: ENSMUST00000088842
SMART Domains Protein: ENSMUSP00000086225
Gene: ENSMUSG00000040464

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
Pfam:FeoB_N 75 163 3e-7 PFAM
Pfam:MMR_HSR1 77 200 2.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115441
AA Change: G124V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111101
Gene: ENSMUSG00000040464
AA Change: G124V

DomainStartEndE-ValueType
Pfam:GTP1_OBG 15 142 1.3e-18 PFAM
Pfam:FeoB_N 149 241 1.4e-8 PFAM
Pfam:MMR_HSR1 150 279 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119521
SMART Domains Protein: ENSMUSP00000113648
Gene: ENSMUSG00000040464

DomainStartEndE-ValueType
Pfam:GTP1_OBG 15 118 6.7e-14 PFAM
Pfam:MMR_HSR1 95 206 2.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126855
SMART Domains Protein: ENSMUSP00000118395
Gene: ENSMUSG00000040464

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121101
Gene: ENSMUSG00000040464
AA Change: G66V

DomainStartEndE-ValueType
Pfam:GTP1_OBG 1 85 2.7e-11 PFAM
low complexity region 101 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147244
SMART Domains Protein: ENSMUSP00000119250
Gene: ENSMUSG00000040464

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198799
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Small G proteins, such as GTPBP10, act as molecular switches that play crucial roles in the regulation of fundamental cellular processes such as protein synthesis, nuclear transport, membrane trafficking, and signal transduction (Hirano et al., 2006 [PubMed 17054726]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,981,335 L800H unknown Het
Ap2b1 T A 11: 83,389,726 D788E probably damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgap9 G A 10: 127,326,643 E348K probably benign Het
B4galnt2 A T 11: 95,891,930 F19I probably benign Het
Bdp1 A T 13: 100,074,531 I551N probably damaging Het
Ceacam16 A G 7: 19,852,305 *427Q probably null Het
Chd9 A C 8: 90,978,914 Q260P probably benign Het
Col16a1 A T 4: 130,093,087 probably benign Het
Csmd1 A T 8: 17,216,789 N40K possibly damaging Het
Depdc5 T G 5: 32,983,860 V1368G probably damaging Het
Dnah7b C A 1: 46,358,238 P3943Q probably damaging Het
Dnttip2 A G 3: 122,282,492 Q691R probably damaging Het
Dusp10 T C 1: 184,068,888 L284P probably damaging Het
Efr3b A G 12: 3,968,624 V574A probably benign Het
Erc2 A T 14: 27,898,596 I60F probably damaging Het
Exoc2 A G 13: 30,911,178 V245A probably benign Het
Fasl G T 1: 161,781,675 F37L probably damaging Het
Fat3 G A 9: 16,029,916 P1360S probably benign Het
Gm12666 A G 4: 92,191,589 I54T probably damaging Het
Gpsm1 C T 2: 26,340,543 P502S probably benign Het
Insm2 T C 12: 55,600,178 C236R probably damaging Het
Irf2bpl A G 12: 86,882,694 Y402H possibly damaging Het
Irx6 A G 8: 92,677,330 E175G probably damaging Het
Kcnh8 C T 17: 52,877,943 R418* probably null Het
Kif3c G A 12: 3,366,114 R45Q probably benign Het
Lpin1 A G 12: 16,580,861 F12S probably damaging Het
Lrba A T 3: 86,619,590 T156S probably benign Het
Lrrc19 G T 4: 94,639,373 N200K probably benign Het
Lrrc7 G A 3: 158,156,913 H1296Y probably benign Het
Ltn1 A T 16: 87,415,690 F661Y probably damaging Het
Macf1 T C 4: 123,457,800 Y1893C probably benign Het
Mmd G C 11: 90,257,536 A15P probably damaging Het
Myh2 T C 11: 67,197,266 F1903L probably benign Het
Myom3 T C 4: 135,801,060 L1072P probably damaging Het
Olfr1350 G A 7: 6,570,321 C110Y probably damaging Het
Olfr1402 A T 3: 97,410,802 Y126* probably null Het
Olfr680-ps1 T C 7: 105,091,256 I128V probably benign Het
Olfr855 A T 9: 19,584,590 T18S possibly damaging Het
Patl2 A T 2: 122,128,929 V18D possibly damaging Het
Pkn1 T C 8: 83,683,426 S395G probably damaging Het
Ptprm A G 17: 66,912,418 I726T possibly damaging Het
Rab3gap2 T C 1: 185,236,012 L187P probably damaging Het
Ric1 A T 19: 29,585,782 E535V probably damaging Het
Ripor3 T C 2: 167,985,737 K598R probably benign Het
Rnf40 A G 7: 127,596,323 E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sbsn A G 7: 30,753,191 T544A probably benign Het
Scaf1 C A 7: 45,007,829 probably benign Het
Sec24a T C 11: 51,700,816 M1018V probably benign Het
Shmt1 C T 11: 60,804,327 A54T probably damaging Het
Slc39a14 C A 14: 70,308,826 V383F probably damaging Het
Slc5a2 A G 7: 128,272,077 T346A probably benign Het
Slco4a1 G A 2: 180,464,808 S261N probably benign Het
Smarcc1 C G 9: 110,196,320 S688R probably damaging Het
Sppl2b G A 10: 80,865,125 A314T probably damaging Het
Sptb A T 12: 76,608,007 V1513E probably damaging Het
Stx17 A T 4: 48,140,462 I56F probably damaging Het
Tbc1d9 A G 8: 83,241,542 Y424C probably damaging Het
Tgm3 A G 2: 130,042,029 K536E probably benign Het
Tti2 A G 8: 31,154,301 I309V possibly damaging Het
Tymp G A 15: 89,374,048 S334L probably benign Het
Unc13b T C 4: 43,263,538 F1587L possibly damaging Het
Vgf G T 5: 137,031,653 probably benign Het
Zfp59 T C 7: 27,853,497 S125P probably damaging Het
Zfp641 A T 15: 98,290,567 M144K possibly damaging Het
Zfp93 A T 7: 24,275,381 K264* probably null Het
Other mutations in Gtpbp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Gtpbp10 APN 5 5546372 missense possibly damaging 0.71
IGL02654:Gtpbp10 APN 5 5543372 unclassified probably benign
IGL03170:Gtpbp10 APN 5 5555355 missense probably benign 0.03
R0421:Gtpbp10 UTSW 5 5557290 missense probably benign 0.00
R4582:Gtpbp10 UTSW 5 5542395 missense possibly damaging 0.95
R4832:Gtpbp10 UTSW 5 5539295 missense possibly damaging 0.85
R6437:Gtpbp10 UTSW 5 5557406 missense probably damaging 1.00
R7072:Gtpbp10 UTSW 5 5546365 missense probably benign
R7349:Gtpbp10 UTSW 5 5555379 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAGTTTCCAAACCAACAGGAG -3'
(R):5'- AAGGCAGCCCTAGAGAGTTG -3'

Sequencing Primer
(F):5'- GTGATGAAATTTGTGCCTTAACTC -3'
(R):5'- AGAGTTGCTCTTAAAAGTGTGTTG -3'
Posted On2018-11-28