Incidental Mutation 'R6969:Or5bw2'
ID 543374
Institutional Source Beutler Lab
Gene Symbol Or5bw2
Ensembl Gene ENSMUSG00000056696
Gene Name olfactory receptor family 5 subfamily BW member 2
Synonyms GA_x6K02T2QGBW-3300391-3301317, MOR222-3, Olfr1350
MMRRC Submission 045079-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R6969 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 6572992-6573918 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 6573320 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 110 (C110Y)
Ref Sequence ENSEMBL: ENSMUSP00000151318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070985] [ENSMUST00000207221] [ENSMUST00000219278]
AlphaFold Q8VF34
Predicted Effect probably damaging
Transcript: ENSMUST00000070985
AA Change: C110Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069927
Gene: ENSMUSG00000056696
AA Change: C110Y

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.6e-50 PFAM
Pfam:7tm_1 39 288 8.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207221
AA Change: C110Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000219278
AA Change: C110Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,958,317 (GRCm39) L800H unknown Het
Ap2b1 T A 11: 83,280,552 (GRCm39) D788E probably damaging Het
Arfgef1 T C 1: 10,223,903 (GRCm39) Q1465R probably damaging Het
Arfgef1 G T 1: 10,223,904 (GRCm39) Q1465K probably damaging Het
Arhgap9 G A 10: 127,162,512 (GRCm39) E348K probably benign Het
B4galnt2 A T 11: 95,782,756 (GRCm39) F19I probably benign Het
Bdp1 A T 13: 100,211,039 (GRCm39) I551N probably damaging Het
Ceacam16 A G 7: 19,586,230 (GRCm39) *427Q probably null Het
Chd9 A C 8: 91,705,542 (GRCm39) Q260P probably benign Het
Col16a1 A T 4: 129,986,880 (GRCm39) probably benign Het
Csmd1 A T 8: 17,266,805 (GRCm39) N40K possibly damaging Het
Depdc5 T G 5: 33,141,204 (GRCm39) V1368G probably damaging Het
Dnah7b C A 1: 46,397,398 (GRCm39) P3943Q probably damaging Het
Dnttip2 A G 3: 122,076,141 (GRCm39) Q691R probably damaging Het
Dusp10 T C 1: 183,801,085 (GRCm39) L284P probably damaging Het
Efr3b A G 12: 4,018,624 (GRCm39) V574A probably benign Het
Erc2 A T 14: 27,620,553 (GRCm39) I60F probably damaging Het
Exoc2 A G 13: 31,095,161 (GRCm39) V245A probably benign Het
Fasl G T 1: 161,609,244 (GRCm39) F37L probably damaging Het
Fat3 G A 9: 15,941,212 (GRCm39) P1360S probably benign Het
Gpsm1 C T 2: 26,230,555 (GRCm39) P502S probably benign Het
Gtpbp10 C A 5: 5,605,331 (GRCm39) G124V probably damaging Het
Insm2 T C 12: 55,646,963 (GRCm39) C236R probably damaging Het
Irf2bpl A G 12: 86,929,468 (GRCm39) Y402H possibly damaging Het
Irx6 A G 8: 93,403,958 (GRCm39) E175G probably damaging Het
Kcnh8 C T 17: 53,184,971 (GRCm39) R418* probably null Het
Kif3c G A 12: 3,416,114 (GRCm39) R45Q probably benign Het
Larp7-ps A G 4: 92,079,826 (GRCm39) I54T probably damaging Het
Lpin1 A G 12: 16,630,862 (GRCm39) F12S probably damaging Het
Lrba A T 3: 86,526,897 (GRCm39) T156S probably benign Het
Lrrc19 G T 4: 94,527,610 (GRCm39) N200K probably benign Het
Lrrc7 G A 3: 157,862,550 (GRCm39) H1296Y probably benign Het
Ltn1 A T 16: 87,212,578 (GRCm39) F661Y probably damaging Het
Macf1 T C 4: 123,351,593 (GRCm39) Y1893C probably benign Het
Mmd G C 11: 90,148,362 (GRCm39) A15P probably damaging Het
Myh2 T C 11: 67,088,092 (GRCm39) F1903L probably benign Het
Myom3 T C 4: 135,528,371 (GRCm39) L1072P probably damaging Het
Or13l2 A T 3: 97,318,118 (GRCm39) Y126* probably null Het
Or56a41 T C 7: 104,740,463 (GRCm39) I128V probably benign Het
Or7g35 A T 9: 19,495,886 (GRCm39) T18S possibly damaging Het
Patl2 A T 2: 121,959,410 (GRCm39) V18D possibly damaging Het
Pkn1 T C 8: 84,410,055 (GRCm39) S395G probably damaging Het
Ptprm A G 17: 67,219,413 (GRCm39) I726T possibly damaging Het
Rab3gap2 T C 1: 184,968,209 (GRCm39) L187P probably damaging Het
Ric1 A T 19: 29,563,182 (GRCm39) E535V probably damaging Het
Ripor3 T C 2: 167,827,657 (GRCm39) K598R probably benign Het
Rnf40 A G 7: 127,195,495 (GRCm39) E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sbsn A G 7: 30,452,616 (GRCm39) T544A probably benign Het
Scaf1 C A 7: 44,657,253 (GRCm39) probably benign Het
Sec24a T C 11: 51,591,643 (GRCm39) M1018V probably benign Het
Shmt1 C T 11: 60,695,153 (GRCm39) A54T probably damaging Het
Slc39a14 C A 14: 70,546,275 (GRCm39) V383F probably damaging Het
Slc5a2 A G 7: 127,871,249 (GRCm39) T346A probably benign Het
Slco4a1 G A 2: 180,106,601 (GRCm39) S261N probably benign Het
Smarcc1 C G 9: 110,025,388 (GRCm39) S688R probably damaging Het
Sppl2b G A 10: 80,700,959 (GRCm39) A314T probably damaging Het
Sptb A T 12: 76,654,781 (GRCm39) V1513E probably damaging Het
Stx17 A T 4: 48,140,462 (GRCm39) I56F probably damaging Het
Tbc1d9 A G 8: 83,968,171 (GRCm39) Y424C probably damaging Het
Tgm3 A G 2: 129,883,949 (GRCm39) K536E probably benign Het
Tti2 A G 8: 31,644,329 (GRCm39) I309V possibly damaging Het
Tymp G A 15: 89,258,251 (GRCm39) S334L probably benign Het
Unc13b T C 4: 43,263,538 (GRCm39) F1587L possibly damaging Het
Vgf G T 5: 137,060,507 (GRCm39) probably benign Het
Zfp59 T C 7: 27,552,922 (GRCm39) S125P probably damaging Het
Zfp641 A T 15: 98,188,448 (GRCm39) M144K possibly damaging Het
Zfp93 A T 7: 23,974,806 (GRCm39) K264* probably null Het
Other mutations in Or5bw2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Or5bw2 APN 7 6,573,667 (GRCm39) missense possibly damaging 0.88
IGL01387:Or5bw2 APN 7 6,573,854 (GRCm39) missense probably damaging 1.00
IGL01457:Or5bw2 APN 7 6,573,211 (GRCm39) missense probably benign 0.12
IGL01568:Or5bw2 APN 7 6,573,569 (GRCm39) missense possibly damaging 0.91
I2288:Or5bw2 UTSW 7 6,573,818 (GRCm39) missense probably damaging 1.00
I2289:Or5bw2 UTSW 7 6,573,818 (GRCm39) missense probably damaging 1.00
R0454:Or5bw2 UTSW 7 6,573,359 (GRCm39) missense probably damaging 1.00
R0558:Or5bw2 UTSW 7 6,573,652 (GRCm39) missense possibly damaging 0.77
R1103:Or5bw2 UTSW 7 6,573,111 (GRCm39) missense probably damaging 1.00
R1352:Or5bw2 UTSW 7 6,573,782 (GRCm39) missense probably benign 0.11
R1503:Or5bw2 UTSW 7 6,573,470 (GRCm39) missense probably damaging 1.00
R1630:Or5bw2 UTSW 7 6,573,673 (GRCm39) missense probably damaging 1.00
R1981:Or5bw2 UTSW 7 6,573,557 (GRCm39) missense probably benign 0.01
R2228:Or5bw2 UTSW 7 6,573,802 (GRCm39) missense probably benign
R2258:Or5bw2 UTSW 7 6,573,022 (GRCm39) missense probably damaging 0.98
R2259:Or5bw2 UTSW 7 6,573,022 (GRCm39) missense probably damaging 0.98
R2260:Or5bw2 UTSW 7 6,573,022 (GRCm39) missense probably damaging 0.98
R4075:Or5bw2 UTSW 7 6,573,142 (GRCm39) missense probably benign 0.00
R4750:Or5bw2 UTSW 7 6,573,850 (GRCm39) missense probably benign 0.34
R4917:Or5bw2 UTSW 7 6,573,643 (GRCm39) missense possibly damaging 0.88
R4918:Or5bw2 UTSW 7 6,573,643 (GRCm39) missense possibly damaging 0.88
R5571:Or5bw2 UTSW 7 6,573,824 (GRCm39) missense possibly damaging 0.95
R5915:Or5bw2 UTSW 7 6,573,172 (GRCm39) missense probably benign 0.31
R7061:Or5bw2 UTSW 7 6,573,782 (GRCm39) missense probably damaging 1.00
R7286:Or5bw2 UTSW 7 6,573,715 (GRCm39) missense probably damaging 1.00
R7510:Or5bw2 UTSW 7 6,572,960 (GRCm39) start gained probably benign
R9475:Or5bw2 UTSW 7 6,573,818 (GRCm39) missense probably damaging 1.00
V1662:Or5bw2 UTSW 7 6,573,818 (GRCm39) missense probably damaging 1.00
Z1176:Or5bw2 UTSW 7 6,573,047 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACACACCCATGTACTTC -3'
(R):5'- CACCACAAGCTAGATGCATGAG -3'

Sequencing Primer
(F):5'- CTTCATCAAACACCTCTCCCTAGTGG -3'
(R):5'- GTGATCAATCATGTTGGGACCAC -3'
Posted On 2018-11-28