Incidental Mutation 'R6969:Olfr1350'
ID543374
Institutional Source Beutler Lab
Gene Symbol Olfr1350
Ensembl Gene ENSMUSG00000056696
Gene Nameolfactory receptor 1350
SynonymsGA_x6K02T2QGBW-3300391-3301317, MOR222-3
MMRRC Submission
Accession Numbers

Genbank: NM_146389.1

Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6969 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location6564841-6571401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6570321 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 110 (C110Y)
Ref Sequence ENSEMBL: ENSMUSP00000151318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070985] [ENSMUST00000207221] [ENSMUST00000219278]
Predicted Effect probably damaging
Transcript: ENSMUST00000070985
AA Change: C110Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069927
Gene: ENSMUSG00000056696
AA Change: C110Y

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.6e-50 PFAM
Pfam:7tm_1 39 288 8.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207221
AA Change: C110Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000219278
AA Change: C110Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,981,335 L800H unknown Het
Ap2b1 T A 11: 83,389,726 D788E probably damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgap9 G A 10: 127,326,643 E348K probably benign Het
B4galnt2 A T 11: 95,891,930 F19I probably benign Het
Bdp1 A T 13: 100,074,531 I551N probably damaging Het
Ceacam16 A G 7: 19,852,305 *427Q probably null Het
Chd9 A C 8: 90,978,914 Q260P probably benign Het
Col16a1 A T 4: 130,093,087 probably benign Het
Csmd1 A T 8: 17,216,789 N40K possibly damaging Het
Depdc5 T G 5: 32,983,860 V1368G probably damaging Het
Dnah7b C A 1: 46,358,238 P3943Q probably damaging Het
Dnttip2 A G 3: 122,282,492 Q691R probably damaging Het
Dusp10 T C 1: 184,068,888 L284P probably damaging Het
Efr3b A G 12: 3,968,624 V574A probably benign Het
Erc2 A T 14: 27,898,596 I60F probably damaging Het
Exoc2 A G 13: 30,911,178 V245A probably benign Het
Fasl G T 1: 161,781,675 F37L probably damaging Het
Fat3 G A 9: 16,029,916 P1360S probably benign Het
Gm12666 A G 4: 92,191,589 I54T probably damaging Het
Gpsm1 C T 2: 26,340,543 P502S probably benign Het
Gtpbp10 C A 5: 5,555,331 G124V probably damaging Het
Insm2 T C 12: 55,600,178 C236R probably damaging Het
Irf2bpl A G 12: 86,882,694 Y402H possibly damaging Het
Irx6 A G 8: 92,677,330 E175G probably damaging Het
Kcnh8 C T 17: 52,877,943 R418* probably null Het
Kif3c G A 12: 3,366,114 R45Q probably benign Het
Lpin1 A G 12: 16,580,861 F12S probably damaging Het
Lrba A T 3: 86,619,590 T156S probably benign Het
Lrrc19 G T 4: 94,639,373 N200K probably benign Het
Lrrc7 G A 3: 158,156,913 H1296Y probably benign Het
Ltn1 A T 16: 87,415,690 F661Y probably damaging Het
Macf1 T C 4: 123,457,800 Y1893C probably benign Het
Mmd G C 11: 90,257,536 A15P probably damaging Het
Myh2 T C 11: 67,197,266 F1903L probably benign Het
Myom3 T C 4: 135,801,060 L1072P probably damaging Het
Olfr1402 A T 3: 97,410,802 Y126* probably null Het
Olfr680-ps1 T C 7: 105,091,256 I128V probably benign Het
Olfr855 A T 9: 19,584,590 T18S possibly damaging Het
Patl2 A T 2: 122,128,929 V18D possibly damaging Het
Pkn1 T C 8: 83,683,426 S395G probably damaging Het
Ptprm A G 17: 66,912,418 I726T possibly damaging Het
Rab3gap2 T C 1: 185,236,012 L187P probably damaging Het
Ric1 A T 19: 29,585,782 E535V probably damaging Het
Ripor3 T C 2: 167,985,737 K598R probably benign Het
Rnf40 A G 7: 127,596,323 E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sbsn A G 7: 30,753,191 T544A probably benign Het
Scaf1 C A 7: 45,007,829 probably benign Het
Sec24a T C 11: 51,700,816 M1018V probably benign Het
Shmt1 C T 11: 60,804,327 A54T probably damaging Het
Slc39a14 C A 14: 70,308,826 V383F probably damaging Het
Slc5a2 A G 7: 128,272,077 T346A probably benign Het
Slco4a1 G A 2: 180,464,808 S261N probably benign Het
Smarcc1 C G 9: 110,196,320 S688R probably damaging Het
Sppl2b G A 10: 80,865,125 A314T probably damaging Het
Sptb A T 12: 76,608,007 V1513E probably damaging Het
Stx17 A T 4: 48,140,462 I56F probably damaging Het
Tbc1d9 A G 8: 83,241,542 Y424C probably damaging Het
Tgm3 A G 2: 130,042,029 K536E probably benign Het
Tti2 A G 8: 31,154,301 I309V possibly damaging Het
Tymp G A 15: 89,374,048 S334L probably benign Het
Unc13b T C 4: 43,263,538 F1587L possibly damaging Het
Vgf G T 5: 137,031,653 probably benign Het
Zfp59 T C 7: 27,853,497 S125P probably damaging Het
Zfp641 A T 15: 98,290,567 M144K possibly damaging Het
Zfp93 A T 7: 24,275,381 K264* probably null Het
Other mutations in Olfr1350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Olfr1350 APN 7 6570668 missense possibly damaging 0.88
IGL01387:Olfr1350 APN 7 6570855 missense probably damaging 1.00
IGL01457:Olfr1350 APN 7 6570212 missense probably benign 0.12
IGL01568:Olfr1350 APN 7 6570570 missense possibly damaging 0.91
I2288:Olfr1350 UTSW 7 6570819 missense probably damaging 1.00
I2289:Olfr1350 UTSW 7 6570819 missense probably damaging 1.00
R0454:Olfr1350 UTSW 7 6570360 missense probably damaging 1.00
R0558:Olfr1350 UTSW 7 6570653 missense possibly damaging 0.77
R1103:Olfr1350 UTSW 7 6570112 missense probably damaging 1.00
R1352:Olfr1350 UTSW 7 6570783 missense probably benign 0.11
R1503:Olfr1350 UTSW 7 6570471 missense probably damaging 1.00
R1630:Olfr1350 UTSW 7 6570674 missense probably damaging 1.00
R1981:Olfr1350 UTSW 7 6570558 missense probably benign 0.01
R2228:Olfr1350 UTSW 7 6570803 missense probably benign
R2258:Olfr1350 UTSW 7 6570023 missense probably damaging 0.98
R2259:Olfr1350 UTSW 7 6570023 missense probably damaging 0.98
R2260:Olfr1350 UTSW 7 6570023 missense probably damaging 0.98
R4075:Olfr1350 UTSW 7 6570143 missense probably benign 0.00
R4750:Olfr1350 UTSW 7 6570851 missense probably benign 0.34
R4917:Olfr1350 UTSW 7 6570644 missense possibly damaging 0.88
R4918:Olfr1350 UTSW 7 6570644 missense possibly damaging 0.88
R5571:Olfr1350 UTSW 7 6570825 missense possibly damaging 0.95
R5915:Olfr1350 UTSW 7 6570173 missense probably benign 0.31
R7061:Olfr1350 UTSW 7 6570783 missense probably damaging 1.00
R7286:Olfr1350 UTSW 7 6570716 missense probably damaging 1.00
R7510:Olfr1350 UTSW 7 6569961 start gained probably benign
V1662:Olfr1350 UTSW 7 6570819 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACACACCCATGTACTTC -3'
(R):5'- CACCACAAGCTAGATGCATGAG -3'

Sequencing Primer
(F):5'- CTTCATCAAACACCTCTCCCTAGTGG -3'
(R):5'- GTGATCAATCATGTTGGGACCAC -3'
Posted On2018-11-28