Incidental Mutation 'R6969:Sbsn'
ID 543378
Institutional Source Beutler Lab
Gene Symbol Sbsn
Ensembl Gene ENSMUSG00000046056
Gene Name suprabasin
Synonyms 1110005D19Rik
MMRRC Submission 045079-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R6969 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 30450896-30455559 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30452616 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 544 (T544A)
Ref Sequence ENSEMBL: ENSMUSP00000079362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080518] [ENSMUST00000182227] [ENSMUST00000182229] [ENSMUST00000182721]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000080518
AA Change: T544A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079362
Gene: ENSMUSG00000046056
AA Change: T544A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
internal_repeat_2 27 208 2.58e-16 PROSPERO
internal_repeat_1 39 233 7e-25 PROSPERO
low complexity region 295 307 N/A INTRINSIC
low complexity region 313 325 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 349 361 N/A INTRINSIC
internal_repeat_2 380 568 2.58e-16 PROSPERO
internal_repeat_1 446 626 7e-25 PROSPERO
low complexity region 637 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182227
SMART Domains Protein: ENSMUSP00000138427
Gene: ENSMUSG00000046056

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 47 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182229
SMART Domains Protein: ENSMUSP00000138561
Gene: ENSMUSG00000046056

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 114 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182721
SMART Domains Protein: ENSMUSP00000138654
Gene: ENSMUSG00000046056

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
internal_repeat_1 26 68 1.41e-7 PROSPERO
internal_repeat_1 84 126 1.41e-7 PROSPERO
low complexity region 128 145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,958,317 (GRCm39) L800H unknown Het
Ap2b1 T A 11: 83,280,552 (GRCm39) D788E probably damaging Het
Arfgef1 G T 1: 10,223,904 (GRCm39) Q1465K probably damaging Het
Arfgef1 T C 1: 10,223,903 (GRCm39) Q1465R probably damaging Het
Arhgap9 G A 10: 127,162,512 (GRCm39) E348K probably benign Het
B4galnt2 A T 11: 95,782,756 (GRCm39) F19I probably benign Het
Bdp1 A T 13: 100,211,039 (GRCm39) I551N probably damaging Het
Ceacam16 A G 7: 19,586,230 (GRCm39) *427Q probably null Het
Chd9 A C 8: 91,705,542 (GRCm39) Q260P probably benign Het
Col16a1 A T 4: 129,986,880 (GRCm39) probably benign Het
Csmd1 A T 8: 17,266,805 (GRCm39) N40K possibly damaging Het
Depdc5 T G 5: 33,141,204 (GRCm39) V1368G probably damaging Het
Dnah7b C A 1: 46,397,398 (GRCm39) P3943Q probably damaging Het
Dnttip2 A G 3: 122,076,141 (GRCm39) Q691R probably damaging Het
Dusp10 T C 1: 183,801,085 (GRCm39) L284P probably damaging Het
Efr3b A G 12: 4,018,624 (GRCm39) V574A probably benign Het
Erc2 A T 14: 27,620,553 (GRCm39) I60F probably damaging Het
Exoc2 A G 13: 31,095,161 (GRCm39) V245A probably benign Het
Fasl G T 1: 161,609,244 (GRCm39) F37L probably damaging Het
Fat3 G A 9: 15,941,212 (GRCm39) P1360S probably benign Het
Gpsm1 C T 2: 26,230,555 (GRCm39) P502S probably benign Het
Gtpbp10 C A 5: 5,605,331 (GRCm39) G124V probably damaging Het
Insm2 T C 12: 55,646,963 (GRCm39) C236R probably damaging Het
Irf2bpl A G 12: 86,929,468 (GRCm39) Y402H possibly damaging Het
Irx6 A G 8: 93,403,958 (GRCm39) E175G probably damaging Het
Kcnh8 C T 17: 53,184,971 (GRCm39) R418* probably null Het
Kif3c G A 12: 3,416,114 (GRCm39) R45Q probably benign Het
Larp7-ps A G 4: 92,079,826 (GRCm39) I54T probably damaging Het
Lpin1 A G 12: 16,630,862 (GRCm39) F12S probably damaging Het
Lrba A T 3: 86,526,897 (GRCm39) T156S probably benign Het
Lrrc19 G T 4: 94,527,610 (GRCm39) N200K probably benign Het
Lrrc7 G A 3: 157,862,550 (GRCm39) H1296Y probably benign Het
Ltn1 A T 16: 87,212,578 (GRCm39) F661Y probably damaging Het
Macf1 T C 4: 123,351,593 (GRCm39) Y1893C probably benign Het
Mmd G C 11: 90,148,362 (GRCm39) A15P probably damaging Het
Myh2 T C 11: 67,088,092 (GRCm39) F1903L probably benign Het
Myom3 T C 4: 135,528,371 (GRCm39) L1072P probably damaging Het
Or13l2 A T 3: 97,318,118 (GRCm39) Y126* probably null Het
Or56a41 T C 7: 104,740,463 (GRCm39) I128V probably benign Het
Or5bw2 G A 7: 6,573,320 (GRCm39) C110Y probably damaging Het
Or7g35 A T 9: 19,495,886 (GRCm39) T18S possibly damaging Het
Patl2 A T 2: 121,959,410 (GRCm39) V18D possibly damaging Het
Pkn1 T C 8: 84,410,055 (GRCm39) S395G probably damaging Het
Ptprm A G 17: 67,219,413 (GRCm39) I726T possibly damaging Het
Rab3gap2 T C 1: 184,968,209 (GRCm39) L187P probably damaging Het
Ric1 A T 19: 29,563,182 (GRCm39) E535V probably damaging Het
Ripor3 T C 2: 167,827,657 (GRCm39) K598R probably benign Het
Rnf40 A G 7: 127,195,495 (GRCm39) E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Scaf1 C A 7: 44,657,253 (GRCm39) probably benign Het
Sec24a T C 11: 51,591,643 (GRCm39) M1018V probably benign Het
Shmt1 C T 11: 60,695,153 (GRCm39) A54T probably damaging Het
Slc39a14 C A 14: 70,546,275 (GRCm39) V383F probably damaging Het
Slc5a2 A G 7: 127,871,249 (GRCm39) T346A probably benign Het
Slco4a1 G A 2: 180,106,601 (GRCm39) S261N probably benign Het
Smarcc1 C G 9: 110,025,388 (GRCm39) S688R probably damaging Het
Sppl2b G A 10: 80,700,959 (GRCm39) A314T probably damaging Het
Sptb A T 12: 76,654,781 (GRCm39) V1513E probably damaging Het
Stx17 A T 4: 48,140,462 (GRCm39) I56F probably damaging Het
Tbc1d9 A G 8: 83,968,171 (GRCm39) Y424C probably damaging Het
Tgm3 A G 2: 129,883,949 (GRCm39) K536E probably benign Het
Tti2 A G 8: 31,644,329 (GRCm39) I309V possibly damaging Het
Tymp G A 15: 89,258,251 (GRCm39) S334L probably benign Het
Unc13b T C 4: 43,263,538 (GRCm39) F1587L possibly damaging Het
Vgf G T 5: 137,060,507 (GRCm39) probably benign Het
Zfp59 T C 7: 27,552,922 (GRCm39) S125P probably damaging Het
Zfp641 A T 15: 98,188,448 (GRCm39) M144K possibly damaging Het
Zfp93 A T 7: 23,974,806 (GRCm39) K264* probably null Het
Other mutations in Sbsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01479:Sbsn APN 7 30,451,782 (GRCm39) missense possibly damaging 0.90
IGL02649:Sbsn APN 7 30,452,683 (GRCm39) missense probably damaging 0.96
IGL03154:Sbsn APN 7 30,451,153 (GRCm39) missense possibly damaging 0.94
PIT4495001:Sbsn UTSW 7 30,452,391 (GRCm39) intron probably benign
PIT4687001:Sbsn UTSW 7 30,452,391 (GRCm39) intron probably benign
R0427:Sbsn UTSW 7 30,451,523 (GRCm39) intron probably benign
R0892:Sbsn UTSW 7 30,454,244 (GRCm39) missense possibly damaging 0.46
R1129:Sbsn UTSW 7 30,452,865 (GRCm39) missense probably benign
R1388:Sbsn UTSW 7 30,451,576 (GRCm39) missense probably benign 0.09
R1437:Sbsn UTSW 7 30,452,478 (GRCm39) nonsense probably null
R2436:Sbsn UTSW 7 30,451,655 (GRCm39) missense possibly damaging 0.53
R4020:Sbsn UTSW 7 30,455,390 (GRCm39) missense probably damaging 0.98
R5485:Sbsn UTSW 7 30,452,542 (GRCm39) missense possibly damaging 0.46
R5890:Sbsn UTSW 7 30,452,692 (GRCm39) missense possibly damaging 0.46
R6616:Sbsn UTSW 7 30,452,704 (GRCm39) missense possibly damaging 0.92
R7302:Sbsn UTSW 7 30,451,309 (GRCm39) missense probably benign 0.34
R7455:Sbsn UTSW 7 30,452,602 (GRCm39) missense possibly damaging 0.46
R8225:Sbsn UTSW 7 30,451,869 (GRCm39) missense probably benign 0.00
R8225:Sbsn UTSW 7 30,451,419 (GRCm39) intron probably benign
R8330:Sbsn UTSW 7 30,451,366 (GRCm39) missense possibly damaging 0.83
R8692:Sbsn UTSW 7 30,451,522 (GRCm39) missense unknown
R8815:Sbsn UTSW 7 30,454,227 (GRCm39) splice site probably benign
R9212:Sbsn UTSW 7 30,452,427 (GRCm39) missense probably benign 0.00
R9622:Sbsn UTSW 7 30,452,067 (GRCm39) intron probably benign
R9697:Sbsn UTSW 7 30,452,391 (GRCm39) intron probably benign
Z1088:Sbsn UTSW 7 30,451,176 (GRCm39) nonsense probably null
Z1177:Sbsn UTSW 7 30,451,755 (GRCm39) missense probably benign 0.23
Z1186:Sbsn UTSW 7 30,452,317 (GRCm39) missense probably benign 0.00
Z1186:Sbsn UTSW 7 30,451,273 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAGAATGGAGTCAACCAGGC -3'
(R):5'- TGTTCATTTCCTGGCCAGCAG -3'

Sequencing Primer
(F):5'- AGTCAACCAGGCTCAAAAGG -3'
(R):5'- GACACCTTGGCCAAGCTTC -3'
Posted On 2018-11-28