Incidental Mutation 'R6969:Arhgap9'
ID 543394
Institutional Source Beutler Lab
Gene Symbol Arhgap9
Ensembl Gene ENSMUSG00000040345
Gene Name Rho GTPase activating protein 9
Synonyms
MMRRC Submission 045079-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.198) question?
Stock # R6969 (G1)
Quality Score 95.0077
Status Not validated
Chromosome 10
Chromosomal Location 127157833-127165812 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 127162512 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 348 (E348K)
Ref Sequence ENSEMBL: ENSMUSP00000151690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026474] [ENSMUST00000069548] [ENSMUST00000219026] [ENSMUST00000219511]
AlphaFold Q1HDU4
Predicted Effect probably benign
Transcript: ENSMUST00000026474
SMART Domains Protein: ENSMUSP00000026474
Gene: ENSMUSG00000025407

DomainStartEndE-ValueType
low complexity region 222 237 N/A INTRINSIC
ZnF_C2H2 238 263 1.33e-1 SMART
ZnF_C2H2 271 298 5.72e-1 SMART
ZnF_C2H2 304 328 2.57e-3 SMART
ZnF_C2H2 334 359 1.92e-2 SMART
ZnF_C2H2 365 390 2.61e-4 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 540 562 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 748 759 N/A INTRINSIC
low complexity region 850 873 N/A INTRINSIC
low complexity region 941 962 N/A INTRINSIC
low complexity region 985 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069548
AA Change: E173K

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066455
Gene: ENSMUSG00000040345
AA Change: E173K

DomainStartEndE-ValueType
PH 60 175 8.19e-10 SMART
RhoGAP 276 469 1.94e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219026
AA Change: E173K

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000219511
AA Change: E348K

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho-GAP family of GTPase activating proteins. The protein has substantial GAP activity towards several Rho-family GTPases in vitro, converting them to an inactive GDP-bound state. It is implicated in regulating adhesion of hematopoietic cells to the extracellular matrix. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,958,317 (GRCm39) L800H unknown Het
Ap2b1 T A 11: 83,280,552 (GRCm39) D788E probably damaging Het
Arfgef1 G T 1: 10,223,904 (GRCm39) Q1465K probably damaging Het
Arfgef1 T C 1: 10,223,903 (GRCm39) Q1465R probably damaging Het
B4galnt2 A T 11: 95,782,756 (GRCm39) F19I probably benign Het
Bdp1 A T 13: 100,211,039 (GRCm39) I551N probably damaging Het
Ceacam16 A G 7: 19,586,230 (GRCm39) *427Q probably null Het
Chd9 A C 8: 91,705,542 (GRCm39) Q260P probably benign Het
Col16a1 A T 4: 129,986,880 (GRCm39) probably benign Het
Csmd1 A T 8: 17,266,805 (GRCm39) N40K possibly damaging Het
Depdc5 T G 5: 33,141,204 (GRCm39) V1368G probably damaging Het
Dnah7b C A 1: 46,397,398 (GRCm39) P3943Q probably damaging Het
Dnttip2 A G 3: 122,076,141 (GRCm39) Q691R probably damaging Het
Dusp10 T C 1: 183,801,085 (GRCm39) L284P probably damaging Het
Efr3b A G 12: 4,018,624 (GRCm39) V574A probably benign Het
Erc2 A T 14: 27,620,553 (GRCm39) I60F probably damaging Het
Exoc2 A G 13: 31,095,161 (GRCm39) V245A probably benign Het
Fasl G T 1: 161,609,244 (GRCm39) F37L probably damaging Het
Fat3 G A 9: 15,941,212 (GRCm39) P1360S probably benign Het
Gpsm1 C T 2: 26,230,555 (GRCm39) P502S probably benign Het
Gtpbp10 C A 5: 5,605,331 (GRCm39) G124V probably damaging Het
Insm2 T C 12: 55,646,963 (GRCm39) C236R probably damaging Het
Irf2bpl A G 12: 86,929,468 (GRCm39) Y402H possibly damaging Het
Irx6 A G 8: 93,403,958 (GRCm39) E175G probably damaging Het
Kcnh8 C T 17: 53,184,971 (GRCm39) R418* probably null Het
Kif3c G A 12: 3,416,114 (GRCm39) R45Q probably benign Het
Larp7-ps A G 4: 92,079,826 (GRCm39) I54T probably damaging Het
Lpin1 A G 12: 16,630,862 (GRCm39) F12S probably damaging Het
Lrba A T 3: 86,526,897 (GRCm39) T156S probably benign Het
Lrrc19 G T 4: 94,527,610 (GRCm39) N200K probably benign Het
Lrrc7 G A 3: 157,862,550 (GRCm39) H1296Y probably benign Het
Ltn1 A T 16: 87,212,578 (GRCm39) F661Y probably damaging Het
Macf1 T C 4: 123,351,593 (GRCm39) Y1893C probably benign Het
Mmd G C 11: 90,148,362 (GRCm39) A15P probably damaging Het
Myh2 T C 11: 67,088,092 (GRCm39) F1903L probably benign Het
Myom3 T C 4: 135,528,371 (GRCm39) L1072P probably damaging Het
Or13l2 A T 3: 97,318,118 (GRCm39) Y126* probably null Het
Or56a41 T C 7: 104,740,463 (GRCm39) I128V probably benign Het
Or5bw2 G A 7: 6,573,320 (GRCm39) C110Y probably damaging Het
Or7g35 A T 9: 19,495,886 (GRCm39) T18S possibly damaging Het
Patl2 A T 2: 121,959,410 (GRCm39) V18D possibly damaging Het
Pkn1 T C 8: 84,410,055 (GRCm39) S395G probably damaging Het
Ptprm A G 17: 67,219,413 (GRCm39) I726T possibly damaging Het
Rab3gap2 T C 1: 184,968,209 (GRCm39) L187P probably damaging Het
Ric1 A T 19: 29,563,182 (GRCm39) E535V probably damaging Het
Ripor3 T C 2: 167,827,657 (GRCm39) K598R probably benign Het
Rnf40 A G 7: 127,195,495 (GRCm39) E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sbsn A G 7: 30,452,616 (GRCm39) T544A probably benign Het
Scaf1 C A 7: 44,657,253 (GRCm39) probably benign Het
Sec24a T C 11: 51,591,643 (GRCm39) M1018V probably benign Het
Shmt1 C T 11: 60,695,153 (GRCm39) A54T probably damaging Het
Slc39a14 C A 14: 70,546,275 (GRCm39) V383F probably damaging Het
Slc5a2 A G 7: 127,871,249 (GRCm39) T346A probably benign Het
Slco4a1 G A 2: 180,106,601 (GRCm39) S261N probably benign Het
Smarcc1 C G 9: 110,025,388 (GRCm39) S688R probably damaging Het
Sppl2b G A 10: 80,700,959 (GRCm39) A314T probably damaging Het
Sptb A T 12: 76,654,781 (GRCm39) V1513E probably damaging Het
Stx17 A T 4: 48,140,462 (GRCm39) I56F probably damaging Het
Tbc1d9 A G 8: 83,968,171 (GRCm39) Y424C probably damaging Het
Tgm3 A G 2: 129,883,949 (GRCm39) K536E probably benign Het
Tti2 A G 8: 31,644,329 (GRCm39) I309V possibly damaging Het
Tymp G A 15: 89,258,251 (GRCm39) S334L probably benign Het
Unc13b T C 4: 43,263,538 (GRCm39) F1587L possibly damaging Het
Vgf G T 5: 137,060,507 (GRCm39) probably benign Het
Zfp59 T C 7: 27,552,922 (GRCm39) S125P probably damaging Het
Zfp641 A T 15: 98,188,448 (GRCm39) M144K possibly damaging Het
Zfp93 A T 7: 23,974,806 (GRCm39) K264* probably null Het
Other mutations in Arhgap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Arhgap9 APN 10 127,163,762 (GRCm39) splice site probably benign
IGL01069:Arhgap9 APN 10 127,164,821 (GRCm39) missense probably damaging 1.00
IGL02444:Arhgap9 APN 10 127,163,816 (GRCm39) missense probably damaging 1.00
IGL02707:Arhgap9 APN 10 127,165,476 (GRCm39) missense probably damaging 0.98
R0242:Arhgap9 UTSW 10 127,165,407 (GRCm39) missense probably benign 0.13
R0242:Arhgap9 UTSW 10 127,165,407 (GRCm39) missense probably benign 0.13
R0841:Arhgap9 UTSW 10 127,165,508 (GRCm39) missense probably damaging 0.98
R1084:Arhgap9 UTSW 10 127,163,797 (GRCm39) missense probably damaging 1.00
R1707:Arhgap9 UTSW 10 127,164,758 (GRCm39) missense probably benign 0.00
R1799:Arhgap9 UTSW 10 127,163,593 (GRCm39) missense probably damaging 1.00
R2423:Arhgap9 UTSW 10 127,162,993 (GRCm39) splice site probably null
R2511:Arhgap9 UTSW 10 127,164,854 (GRCm39) critical splice donor site probably null
R3721:Arhgap9 UTSW 10 127,164,840 (GRCm39) missense possibly damaging 0.84
R3803:Arhgap9 UTSW 10 127,165,386 (GRCm39) missense possibly damaging 0.64
R4261:Arhgap9 UTSW 10 127,164,334 (GRCm39) missense probably damaging 1.00
R4968:Arhgap9 UTSW 10 127,162,875 (GRCm39) missense possibly damaging 0.80
R5423:Arhgap9 UTSW 10 127,165,418 (GRCm39) missense probably damaging 1.00
R5425:Arhgap9 UTSW 10 127,162,287 (GRCm39) missense probably damaging 1.00
R6697:Arhgap9 UTSW 10 127,157,989 (GRCm39) missense probably benign 0.34
R8840:Arhgap9 UTSW 10 127,161,009 (GRCm39) missense possibly damaging 0.94
R8844:Arhgap9 UTSW 10 127,161,015 (GRCm39) missense probably benign 0.03
R9084:Arhgap9 UTSW 10 127,158,114 (GRCm39) missense possibly damaging 0.95
R9325:Arhgap9 UTSW 10 127,161,722 (GRCm39) missense probably damaging 1.00
X0067:Arhgap9 UTSW 10 127,164,301 (GRCm39) missense probably damaging 1.00
Z1176:Arhgap9 UTSW 10 127,163,558 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTCCTCGCAGCGTTTTAG -3'
(R):5'- ACACCGGTTCCGATTCCAATTC -3'

Sequencing Primer
(F):5'- GCAGCGTTTTAGGCACTCCTAG -3'
(R):5'- TTGGACAGGAGAACATCTGCACC -3'
Posted On 2018-11-28