Mutagenetix > Incidental Mutation

Incidental Mutation 'R6969:Sec24a'

543395

Institutional Source

Beutler Lab

Gene Symbol

Sec24a

Ensembl Gene

ENSMUSG00000036391

Gene Name

Sec24 related gene family, member A (S. cerevisiae)

Synonyms

9430090N21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6969 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

51692264-51763634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 51700816 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1018 (M1018V)

Ref Sequence

ENSEMBL: ENSMUSP00000104725 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038210] [ENSMUST00000109097]

AlphaFold

Q3U2P1

Predicted Effect

probably benign
Transcript: ENSMUST00000038210
AA Change: M1017V

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000044370
Gene: ENSMUSG00000036391
AA Change: M1017V

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	71	84	N/A	INTRINSIC
low complexity region	196	235	N/A	INTRINSIC
low complexity region	396	414	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	423	461	8e-19	PFAM
Pfam:Sec23_trunk	497	735	1.2e-87	PFAM
Pfam:Sec23_BS	740	824	1.1e-23	PFAM
Pfam:Sec23_helical	836	938	5.1e-27	PFAM
Pfam:Gelsolin	960	1035	7.2e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109097
AA Change: M1018V

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000104725
Gene: ENSMUSG00000036391
AA Change: M1018V

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	71	84	N/A	INTRINSIC
low complexity region	196	235	N/A	INTRINSIC
low complexity region	396	414	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	425	462	2.4e-16	PFAM
Pfam:Sec23_trunk	498	736	7.8e-87	PFAM
Pfam:Sec23_BS	741	825	1.1e-22	PFAM
Pfam:Sec23_helical	838	938	6.9e-28	PFAM
Pfam:Gelsolin	961	1036	9.3e-14	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins that are homologous to yeast Sec24. This protein is a component of coat protein II (COPII)-coated vesicles that mediate protein transport from the endoplasmic reticulum. COPII acts in the cytoplasm to promote the transport of secretory, plasma membrane, and vacuolar proteins from the endoplasmic reticulum to the golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased circulating cholesterol level, decreased circulating LDL cholesterol level, and abnormal liver physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	A	6: 86,981,335	L800H	unknown	Het
Ap2b1	T	A	11: 83,389,726	D788E	probably damaging	Het
Arfgef1	T	C	1: 10,153,678	Q1465R	probably damaging	Het
Arfgef1	G	T	1: 10,153,679	Q1465K	probably damaging	Het
Arhgap9	G	A	10: 127,326,643	E348K	probably benign	Het
B4galnt2	A	T	11: 95,891,930	F19I	probably benign	Het
Bdp1	A	T	13: 100,074,531	I551N	probably damaging	Het
Ceacam16	A	G	7: 19,852,305	*427Q	probably null	Het
Chd9	A	C	8: 90,978,914	Q260P	probably benign	Het
Col16a1	A	T	4: 130,093,087		probably benign	Het
Csmd1	A	T	8: 17,216,789	N40K	possibly damaging	Het
Depdc5	T	G	5: 32,983,860	V1368G	probably damaging	Het
Dnah7b	C	A	1: 46,358,238	P3943Q	probably damaging	Het
Dnttip2	A	G	3: 122,282,492	Q691R	probably damaging	Het
Dusp10	T	C	1: 184,068,888	L284P	probably damaging	Het
Efr3b	A	G	12: 3,968,624	V574A	probably benign	Het
Erc2	A	T	14: 27,898,596	I60F	probably damaging	Het
Exoc2	A	G	13: 30,911,178	V245A	probably benign	Het
Fasl	G	T	1: 161,781,675	F37L	probably damaging	Het
Fat3	G	A	9: 16,029,916	P1360S	probably benign	Het
Gm12666	A	G	4: 92,191,589	I54T	probably damaging	Het
Gpsm1	C	T	2: 26,340,543	P502S	probably benign	Het
Gtpbp10	C	A	5: 5,555,331	G124V	probably damaging	Het
Insm2	T	C	12: 55,600,178	C236R	probably damaging	Het
Irf2bpl	A	G	12: 86,882,694	Y402H	possibly damaging	Het
Irx6	A	G	8: 92,677,330	E175G	probably damaging	Het
Kcnh8	C	T	17: 52,877,943	R418*	probably null	Het
Kif3c	G	A	12: 3,366,114	R45Q	probably benign	Het
Lpin1	A	G	12: 16,580,861	F12S	probably damaging	Het
Lrba	A	T	3: 86,619,590	T156S	probably benign	Het
Lrrc19	G	T	4: 94,639,373	N200K	probably benign	Het
Lrrc7	G	A	3: 158,156,913	H1296Y	probably benign	Het
Ltn1	A	T	16: 87,415,690	F661Y	probably damaging	Het
Macf1	T	C	4: 123,457,800	Y1893C	probably benign	Het
Mmd	G	C	11: 90,257,536	A15P	probably damaging	Het
Myh2	T	C	11: 67,197,266	F1903L	probably benign	Het
Myom3	T	C	4: 135,801,060	L1072P	probably damaging	Het
Olfr1350	G	A	7: 6,570,321	C110Y	probably damaging	Het
Olfr1402	A	T	3: 97,410,802	Y126*	probably null	Het
Olfr680-ps1	T	C	7: 105,091,256	I128V	probably benign	Het
Olfr855	A	T	9: 19,584,590	T18S	possibly damaging	Het
Patl2	A	T	2: 122,128,929	V18D	possibly damaging	Het
Pkn1	T	C	8: 83,683,426	S395G	probably damaging	Het
Ptprm	A	G	17: 66,912,418	I726T	possibly damaging	Het
Rab3gap2	T	C	1: 185,236,012	L187P	probably damaging	Het
Ric1	A	T	19: 29,585,782	E535V	probably damaging	Het
Ripor3	T	C	2: 167,985,737	K598R	probably benign	Het
Rnf40	A	G	7: 127,596,323	E607G	possibly damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Sbsn	A	G	7: 30,753,191	T544A	probably benign	Het
Scaf1	C	A	7: 45,007,829		probably benign	Het
Shmt1	C	T	11: 60,804,327	A54T	probably damaging	Het
Slc39a14	C	A	14: 70,308,826	V383F	probably damaging	Het
Slc5a2	A	G	7: 128,272,077	T346A	probably benign	Het
Slco4a1	G	A	2: 180,464,808	S261N	probably benign	Het
Smarcc1	C	G	9: 110,196,320	S688R	probably damaging	Het
Sppl2b	G	A	10: 80,865,125	A314T	probably damaging	Het
Sptb	A	T	12: 76,608,007	V1513E	probably damaging	Het
Stx17	A	T	4: 48,140,462	I56F	probably damaging	Het
Tbc1d9	A	G	8: 83,241,542	Y424C	probably damaging	Het
Tgm3	A	G	2: 130,042,029	K536E	probably benign	Het
Tti2	A	G	8: 31,154,301	I309V	possibly damaging	Het
Tymp	G	A	15: 89,374,048	S334L	probably benign	Het
Unc13b	T	C	4: 43,263,538	F1587L	possibly damaging	Het
Vgf	G	T	5: 137,031,653		probably benign	Het
Zfp59	T	C	7: 27,853,497	S125P	probably damaging	Het
Zfp641	A	T	15: 98,290,567	M144K	possibly damaging	Het
Zfp93	A	T	7: 24,275,381	K264*	probably null	Het

Other mutations in Sec24a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Sec24a	APN	11	51736504	nonsense	probably null
IGL00973:Sec24a	APN	11	51729577	critical splice acceptor site	probably null
IGL01364:Sec24a	APN	11	51713529	critical splice donor site	probably null
IGL01476:Sec24a	APN	11	51708956	missense	possibly damaging	0.88
IGL01725:Sec24a	APN	11	51723578	splice site	probably null
IGL02069:Sec24a	APN	11	51733934	splice site	probably benign
IGL02230:Sec24a	APN	11	51709034	missense	possibly damaging	0.88
IGL02617:Sec24a	APN	11	51712187	critical splice donor site	probably null
IGL02655:Sec24a	APN	11	51734655	missense	probably benign	0.43
IGL02756:Sec24a	APN	11	51696733	missense	probably benign	0.02
IGL03396:Sec24a	APN	11	51708967	missense	probably benign	0.17
R0153:Sec24a	UTSW	11	51700826	missense	probably benign	0.08
R0506:Sec24a	UTSW	11	51743795	missense	probably benign	0.03
R0625:Sec24a	UTSW	11	51729454	missense	probably damaging	0.98
R1084:Sec24a	UTSW	11	51713581	missense	probably damaging	1.00
R1166:Sec24a	UTSW	11	51733467	missense	possibly damaging	0.72
R1376:Sec24a	UTSW	11	51700913	splice site	probably benign
R1487:Sec24a	UTSW	11	51731886	missense	possibly damaging	0.92
R1541:Sec24a	UTSW	11	51743796	missense	probably benign	0.41
R1582:Sec24a	UTSW	11	51708967	missense	probably benign	0.17
R1643:Sec24a	UTSW	11	51704385	missense	probably benign	0.03
R1672:Sec24a	UTSW	11	51743948	nonsense	probably null
R1681:Sec24a	UTSW	11	51695189	missense	probably damaging	0.98
R1756:Sec24a	UTSW	11	51733763	splice site	probably benign
R1992:Sec24a	UTSW	11	51736363	missense	probably benign	0.00
R2159:Sec24a	UTSW	11	51712350	missense	probably damaging	1.00
R2177:Sec24a	UTSW	11	51704401	missense	probably benign	0.00
R2188:Sec24a	UTSW	11	51723584	missense	probably damaging	0.99
R2271:Sec24a	UTSW	11	51716450	missense	possibly damaging	0.91
R3414:Sec24a	UTSW	11	51729458	missense	probably damaging	1.00
R4349:Sec24a	UTSW	11	51715149	missense	probably benign	0.03
R4396:Sec24a	UTSW	11	51715164	missense	possibly damaging	0.86
R4629:Sec24a	UTSW	11	51721813	critical splice donor site	probably null
R5061:Sec24a	UTSW	11	51713532	splice site	probably null
R5577:Sec24a	UTSW	11	51734621	missense	probably benign	0.06
R5717:Sec24a	UTSW	11	51707210	missense	probably benign
R5915:Sec24a	UTSW	11	51756137	missense	probably benign	0.11
R6175:Sec24a	UTSW	11	51731891	missense	probably damaging	1.00
R6341:Sec24a	UTSW	11	51717776	missense	probably damaging	0.99
R6461:Sec24a	UTSW	11	51713546	missense	possibly damaging	0.76
R6610:Sec24a	UTSW	11	51696656	missense	probably benign
R6632:Sec24a	UTSW	11	51713649	nonsense	probably null
R6907:Sec24a	UTSW	11	51712276	missense	probably damaging	1.00
R7132:Sec24a	UTSW	11	51715136	nonsense	probably null
R7274:Sec24a	UTSW	11	51707255	missense	probably damaging	1.00
R7475:Sec24a	UTSW	11	51713552	missense	probably damaging	1.00
R7699:Sec24a	UTSW	11	51712257	missense	probably damaging	1.00
R7700:Sec24a	UTSW	11	51712257	missense	probably damaging	1.00
R7935:Sec24a	UTSW	11	51721922	missense	probably benign	0.25
R8042:Sec24a	UTSW	11	51704317	missense	probably benign
R8345:Sec24a	UTSW	11	51743778	missense	probably benign	0.00
R9217:Sec24a	UTSW	11	51726504	missense	probably benign	0.14
R9501:Sec24a	UTSW	11	51712295	missense	probably damaging	1.00
X0025:Sec24a	UTSW	11	51729547	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCATTTGAAGACAAAATGAGCCAGG -3'
(R):5'- CAGTCTCACTAAGCATGCTCATG -3'

Sequencing Primer
(F):5'- CTACATAGTGAGTTCTAGGCCAGC -3'
(R):5'- GCTCATGCTTTGACGTTTTAAAGC -3'

Posted On

2018-11-28