Mutagenetix > Incidental Mutation

Incidental Mutation 'R6969:Ap2b1'

543398

Institutional Source

Beutler Lab

Gene Symbol

Ap2b1

Ensembl Gene

ENSMUSG00000035152

Gene Name

adaptor-related protein complex 2, beta 1 subunit

Synonyms

1300012O03Rik

MMRRC Submission

045079-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6969 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

83299024-83405035 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83389726 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 788 (D788E)

Ref Sequence

ENSEMBL: ENSMUSP00000135445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523]

AlphaFold

Q9DBG3

Predicted Effect

probably benign
Transcript: ENSMUST00000018875
AA Change: D826E

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: D826E

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000065692
AA Change: D812E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: D812E

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176430
AA Change: D826E

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: D826E

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000176523
AA Change: D788E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: D788E

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	A	6: 86,981,335	L800H	unknown	Het
Arfgef1	T	C	1: 10,153,678	Q1465R	probably damaging	Het
Arfgef1	G	T	1: 10,153,679	Q1465K	probably damaging	Het
Arhgap9	G	A	10: 127,326,643	E348K	probably benign	Het
B4galnt2	A	T	11: 95,891,930	F19I	probably benign	Het
Bdp1	A	T	13: 100,074,531	I551N	probably damaging	Het
Ceacam16	A	G	7: 19,852,305	*427Q	probably null	Het
Chd9	A	C	8: 90,978,914	Q260P	probably benign	Het
Col16a1	A	T	4: 130,093,087		probably benign	Het
Csmd1	A	T	8: 17,216,789	N40K	possibly damaging	Het
Depdc5	T	G	5: 32,983,860	V1368G	probably damaging	Het
Dnah7b	C	A	1: 46,358,238	P3943Q	probably damaging	Het
Dnttip2	A	G	3: 122,282,492	Q691R	probably damaging	Het
Dusp10	T	C	1: 184,068,888	L284P	probably damaging	Het
Efr3b	A	G	12: 3,968,624	V574A	probably benign	Het
Erc2	A	T	14: 27,898,596	I60F	probably damaging	Het
Exoc2	A	G	13: 30,911,178	V245A	probably benign	Het
Fasl	G	T	1: 161,781,675	F37L	probably damaging	Het
Fat3	G	A	9: 16,029,916	P1360S	probably benign	Het
Gm12666	A	G	4: 92,191,589	I54T	probably damaging	Het
Gpsm1	C	T	2: 26,340,543	P502S	probably benign	Het
Gtpbp10	C	A	5: 5,555,331	G124V	probably damaging	Het
Insm2	T	C	12: 55,600,178	C236R	probably damaging	Het
Irf2bpl	A	G	12: 86,882,694	Y402H	possibly damaging	Het
Irx6	A	G	8: 92,677,330	E175G	probably damaging	Het
Kcnh8	C	T	17: 52,877,943	R418*	probably null	Het
Kif3c	G	A	12: 3,366,114	R45Q	probably benign	Het
Lpin1	A	G	12: 16,580,861	F12S	probably damaging	Het
Lrba	A	T	3: 86,619,590	T156S	probably benign	Het
Lrrc19	G	T	4: 94,639,373	N200K	probably benign	Het
Lrrc7	G	A	3: 158,156,913	H1296Y	probably benign	Het
Ltn1	A	T	16: 87,415,690	F661Y	probably damaging	Het
Macf1	T	C	4: 123,457,800	Y1893C	probably benign	Het
Mmd	G	C	11: 90,257,536	A15P	probably damaging	Het
Myh2	T	C	11: 67,197,266	F1903L	probably benign	Het
Myom3	T	C	4: 135,801,060	L1072P	probably damaging	Het
Olfr1350	G	A	7: 6,570,321	C110Y	probably damaging	Het
Olfr1402	A	T	3: 97,410,802	Y126*	probably null	Het
Olfr680-ps1	T	C	7: 105,091,256	I128V	probably benign	Het
Olfr855	A	T	9: 19,584,590	T18S	possibly damaging	Het
Patl2	A	T	2: 122,128,929	V18D	possibly damaging	Het
Pkn1	T	C	8: 83,683,426	S395G	probably damaging	Het
Ptprm	A	G	17: 66,912,418	I726T	possibly damaging	Het
Rab3gap2	T	C	1: 185,236,012	L187P	probably damaging	Het
Ric1	A	T	19: 29,585,782	E535V	probably damaging	Het
Ripor3	T	C	2: 167,985,737	K598R	probably benign	Het
Rnf40	A	G	7: 127,596,323	E607G	possibly damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Sbsn	A	G	7: 30,753,191	T544A	probably benign	Het
Scaf1	C	A	7: 45,007,829		probably benign	Het
Sec24a	T	C	11: 51,700,816	M1018V	probably benign	Het
Shmt1	C	T	11: 60,804,327	A54T	probably damaging	Het
Slc39a14	C	A	14: 70,308,826	V383F	probably damaging	Het
Slc5a2	A	G	7: 128,272,077	T346A	probably benign	Het
Slco4a1	G	A	2: 180,464,808	S261N	probably benign	Het
Smarcc1	C	G	9: 110,196,320	S688R	probably damaging	Het
Sppl2b	G	A	10: 80,865,125	A314T	probably damaging	Het
Sptb	A	T	12: 76,608,007	V1513E	probably damaging	Het
Stx17	A	T	4: 48,140,462	I56F	probably damaging	Het
Tbc1d9	A	G	8: 83,241,542	Y424C	probably damaging	Het
Tgm3	A	G	2: 130,042,029	K536E	probably benign	Het
Tti2	A	G	8: 31,154,301	I309V	possibly damaging	Het
Tymp	G	A	15: 89,374,048	S334L	probably benign	Het
Unc13b	T	C	4: 43,263,538	F1587L	possibly damaging	Het
Vgf	G	T	5: 137,031,653		probably benign	Het
Zfp59	T	C	7: 27,853,497	S125P	probably damaging	Het
Zfp641	A	T	15: 98,290,567	M144K	possibly damaging	Het
Zfp93	A	T	7: 24,275,381	K264*	probably null	Het

Other mutations in Ap2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Ap2b1	APN	11	83333158	missense	probably damaging	0.99
IGL01583:Ap2b1	APN	11	83324611	missense	possibly damaging	0.61
IGL01753:Ap2b1	APN	11	83321973	missense	probably damaging	1.00
IGL01992:Ap2b1	APN	11	83335530	missense	probably damaging	1.00
IGL02192:Ap2b1	APN	11	83346766	missense	possibly damaging	0.48
IGL02315:Ap2b1	APN	11	83336799	missense	probably damaging	0.96
IGL03235:Ap2b1	APN	11	83341384	missense	probably benign	0.41
P0045:Ap2b1	UTSW	11	83368026	missense	probably damaging	1.00
R0121:Ap2b1	UTSW	11	83321967	missense	possibly damaging	0.66
R0334:Ap2b1	UTSW	11	83367874	splice site	probably benign
R1222:Ap2b1	UTSW	11	83346738	missense	probably benign	0.06
R1297:Ap2b1	UTSW	11	83333109	missense	probably damaging	1.00
R1653:Ap2b1	UTSW	11	83346831	missense	probably damaging	1.00
R1719:Ap2b1	UTSW	11	83324604	missense	probably damaging	1.00
R1885:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1886:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1965:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R1966:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R2046:Ap2b1	UTSW	11	83336386	missense	probably benign	0.14
R2086:Ap2b1	UTSW	11	83351118	missense	possibly damaging	0.88
R2132:Ap2b1	UTSW	11	83324761	splice site	probably benign
R3615:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3616:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3983:Ap2b1	UTSW	11	83390716	missense	probably damaging	1.00
R4124:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4125:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4198:Ap2b1	UTSW	11	83342603	missense	probably damaging	1.00
R4202:Ap2b1	UTSW	11	83335604	critical splice donor site	probably null
R4543:Ap2b1	UTSW	11	83324650	missense	probably damaging	1.00
R4583:Ap2b1	UTSW	11	83397779	missense	probably benign	0.00
R4589:Ap2b1	UTSW	11	83333011	nonsense	probably null
R4916:Ap2b1	UTSW	11	83390706	missense	probably damaging	1.00
R5005:Ap2b1	UTSW	11	83339392	missense	probably damaging	1.00
R5385:Ap2b1	UTSW	11	83342601	missense	probably damaging	1.00
R5510:Ap2b1	UTSW	11	83336737	splice site	probably null
R5738:Ap2b1	UTSW	11	83336430	splice site	probably null
R6023:Ap2b1	UTSW	11	83335398	missense	probably damaging	0.99
R6269:Ap2b1	UTSW	11	83346673	missense	probably damaging	1.00
R6383:Ap2b1	UTSW	11	83346825	missense	probably damaging	1.00
R6416:Ap2b1	UTSW	11	83308239	start codon destroyed	probably null	1.00
R6502:Ap2b1	UTSW	11	83342679	missense	probably damaging	0.97
R6810:Ap2b1	UTSW	11	83335491	missense	possibly damaging	0.89
R7238:Ap2b1	UTSW	11	83333122	missense	possibly damaging	0.91
R7241:Ap2b1	UTSW	11	83351105	missense	probably benign	0.16
R7429:Ap2b1	UTSW	11	83367998	missense	probably benign	0.00
R7588:Ap2b1	UTSW	11	83324522	missense	probably benign	0.00
R7635:Ap2b1	UTSW	11	83389728	missense	probably benign	0.09
R7651:Ap2b1	UTSW	11	83339430	critical splice donor site	probably null
R7753:Ap2b1	UTSW	11	83367907	nonsense	probably null
R8468:Ap2b1	UTSW	11	83351065	missense	probably damaging	1.00
R8943:Ap2b1	UTSW	11	83346753	missense	probably damaging	1.00
R9093:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
R9621:Ap2b1	UTSW	11	83402598	missense	probably damaging	1.00
X0064:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
Z1177:Ap2b1	UTSW	11	83365753	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCCTGGAGGGTATACCATAGTC -3'
(R):5'- AGTGACTGGCAAATGACCAATG -3'

Sequencing Primer
(F):5'- CTGGAGGGTATACCATAGTCTTCTAG -3'
(R):5'- CCAATGATCAACTACTTATTGGGGC -3'

Posted On

2018-11-28