Incidental Mutation 'R6969:Efr3b'
ID543402
Institutional Source Beutler Lab
Gene Symbol Efr3b
Ensembl Gene ENSMUSG00000020658
Gene NameEFR3 homolog B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6969 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location3962554-4038915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3968624 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 574 (V574A)
Ref Sequence ENSEMBL: ENSMUSP00000151788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111178] [ENSMUST00000218166] [ENSMUST00000219331]
Predicted Effect probably benign
Transcript: ENSMUST00000111178
AA Change: V734A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106809
Gene: ENSMUSG00000020658
AA Change: V734A

DomainStartEndE-ValueType
SCOP:d1qbkb_ 55 306 1e-3 SMART
low complexity region 591 602 N/A INTRINSIC
low complexity region 736 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218166
AA Change: V574A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000219331
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,981,335 L800H unknown Het
Ap2b1 T A 11: 83,389,726 D788E probably damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgap9 G A 10: 127,326,643 E348K probably benign Het
B4galnt2 A T 11: 95,891,930 F19I probably benign Het
Bdp1 A T 13: 100,074,531 I551N probably damaging Het
Ceacam16 A G 7: 19,852,305 *427Q probably null Het
Chd9 A C 8: 90,978,914 Q260P probably benign Het
Col16a1 A T 4: 130,093,087 probably benign Het
Csmd1 A T 8: 17,216,789 N40K possibly damaging Het
Depdc5 T G 5: 32,983,860 V1368G probably damaging Het
Dnah7b C A 1: 46,358,238 P3943Q probably damaging Het
Dnttip2 A G 3: 122,282,492 Q691R probably damaging Het
Dusp10 T C 1: 184,068,888 L284P probably damaging Het
Erc2 A T 14: 27,898,596 I60F probably damaging Het
Exoc2 A G 13: 30,911,178 V245A probably benign Het
Fasl G T 1: 161,781,675 F37L probably damaging Het
Fat3 G A 9: 16,029,916 P1360S probably benign Het
Gm12666 A G 4: 92,191,589 I54T probably damaging Het
Gpsm1 C T 2: 26,340,543 P502S probably benign Het
Gtpbp10 C A 5: 5,555,331 G124V probably damaging Het
Insm2 T C 12: 55,600,178 C236R probably damaging Het
Irf2bpl A G 12: 86,882,694 Y402H possibly damaging Het
Irx6 A G 8: 92,677,330 E175G probably damaging Het
Kcnh8 C T 17: 52,877,943 R418* probably null Het
Kif3c G A 12: 3,366,114 R45Q probably benign Het
Lpin1 A G 12: 16,580,861 F12S probably damaging Het
Lrba A T 3: 86,619,590 T156S probably benign Het
Lrrc19 G T 4: 94,639,373 N200K probably benign Het
Lrrc7 G A 3: 158,156,913 H1296Y probably benign Het
Ltn1 A T 16: 87,415,690 F661Y probably damaging Het
Macf1 T C 4: 123,457,800 Y1893C probably benign Het
Mmd G C 11: 90,257,536 A15P probably damaging Het
Myh2 T C 11: 67,197,266 F1903L probably benign Het
Myom3 T C 4: 135,801,060 L1072P probably damaging Het
Olfr1350 G A 7: 6,570,321 C110Y probably damaging Het
Olfr1402 A T 3: 97,410,802 Y126* probably null Het
Olfr680-ps1 T C 7: 105,091,256 I128V probably benign Het
Olfr855 A T 9: 19,584,590 T18S possibly damaging Het
Patl2 A T 2: 122,128,929 V18D possibly damaging Het
Pkn1 T C 8: 83,683,426 S395G probably damaging Het
Ptprm A G 17: 66,912,418 I726T possibly damaging Het
Rab3gap2 T C 1: 185,236,012 L187P probably damaging Het
Ric1 A T 19: 29,585,782 E535V probably damaging Het
Ripor3 T C 2: 167,985,737 K598R probably benign Het
Rnf40 A G 7: 127,596,323 E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sbsn A G 7: 30,753,191 T544A probably benign Het
Scaf1 C A 7: 45,007,829 probably benign Het
Sec24a T C 11: 51,700,816 M1018V probably benign Het
Shmt1 C T 11: 60,804,327 A54T probably damaging Het
Slc39a14 C A 14: 70,308,826 V383F probably damaging Het
Slc5a2 A G 7: 128,272,077 T346A probably benign Het
Slco4a1 G A 2: 180,464,808 S261N probably benign Het
Smarcc1 C G 9: 110,196,320 S688R probably damaging Het
Sppl2b G A 10: 80,865,125 A314T probably damaging Het
Sptb A T 12: 76,608,007 V1513E probably damaging Het
Stx17 A T 4: 48,140,462 I56F probably damaging Het
Tbc1d9 A G 8: 83,241,542 Y424C probably damaging Het
Tgm3 A G 2: 130,042,029 K536E probably benign Het
Tti2 A G 8: 31,154,301 I309V possibly damaging Het
Tymp G A 15: 89,374,048 S334L probably benign Het
Unc13b T C 4: 43,263,538 F1587L possibly damaging Het
Vgf G T 5: 137,031,653 probably benign Het
Zfp59 T C 7: 27,853,497 S125P probably damaging Het
Zfp641 A T 15: 98,290,567 M144K possibly damaging Het
Zfp93 A T 7: 24,275,381 K264* probably null Het
Other mutations in Efr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Efr3b APN 12 3975411 nonsense probably null
IGL01288:Efr3b APN 12 3982865 missense probably damaging 1.00
IGL01467:Efr3b APN 12 3969597 missense probably damaging 0.98
IGL01964:Efr3b APN 12 3982928 missense probably damaging 1.00
IGL02253:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02329:Efr3b APN 12 3992923 splice site probably null
IGL02365:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02373:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02390:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02392:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02494:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02496:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02501:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02529:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02530:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02532:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02699:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02716:Efr3b APN 12 3984627 missense probably damaging 1.00
IGL02904:Efr3b APN 12 3984583 missense probably damaging 0.99
IGL02986:Efr3b APN 12 3966495 missense probably benign 0.13
IGL03171:Efr3b APN 12 3968622 missense probably benign 0.00
IGL03346:Efr3b APN 12 3984648 missense probably damaging 1.00
PIT4418001:Efr3b UTSW 12 3980490 missense possibly damaging 0.64
R0017:Efr3b UTSW 12 3993003 missense probably damaging 0.98
R0189:Efr3b UTSW 12 3982925 missense probably damaging 1.00
R0361:Efr3b UTSW 12 3977923 missense probably benign 0.00
R0469:Efr3b UTSW 12 3982058 missense probably benign 0.02
R0510:Efr3b UTSW 12 3982058 missense probably benign 0.02
R0782:Efr3b UTSW 12 3984686 splice site probably benign
R2042:Efr3b UTSW 12 3984627 missense probably damaging 1.00
R2359:Efr3b UTSW 12 3980136 unclassified probably benign
R3691:Efr3b UTSW 12 3982059 missense possibly damaging 0.84
R3849:Efr3b UTSW 12 3983414 missense probably benign 0.40
R5384:Efr3b UTSW 12 3983419 missense probably benign 0.04
R5819:Efr3b UTSW 12 3992965 missense probably benign 0.21
R5970:Efr3b UTSW 12 3968590 missense possibly damaging 0.93
R6031:Efr3b UTSW 12 3967106 missense possibly damaging 0.90
R6031:Efr3b UTSW 12 3967106 missense possibly damaging 0.90
R6759:Efr3b UTSW 12 3984613 missense probably damaging 1.00
R7392:Efr3b UTSW 12 3969588 missense probably benign
R7717:Efr3b UTSW 12 3984574 missense probably damaging 1.00
R8071:Efr3b UTSW 12 3982898 missense probably benign 0.02
R8686:Efr3b UTSW 12 4000886 missense probably damaging 1.00
R8737:Efr3b UTSW 12 3999594 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTTGAACTCGGTTCTGCC -3'
(R):5'- GCCACTTGGGTCTTTAAAAGCTC -3'

Sequencing Primer
(F):5'- GAACTCGGTTCTGCCCTCAAC -3'
(R):5'- GGTCTTTAAAAGCTCAGCTACGGTC -3'
Posted On2018-11-28