Mutagenetix > Incidental Mutation

Incidental Mutation 'R6969:Sptb'

543405

Institutional Source

Beutler Lab

Gene Symbol

Sptb

Ensembl Gene

ENSMUSG00000021061

Gene Name

spectrin beta, erythrocytic

Synonyms

LOC383567, spectrin R, D330027P03Rik, brain erythroid spectrin (235E), Spnb-1, Spnb1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.782) question?

Stock #

R6969 (G1)

Quality Score

126.008

Status

Not validated

Chromosome

Chromosomal Location

76580488-76710547 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 76608007 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1513 (V1513E)

Ref Sequence

ENSEMBL: ENSMUSP00000129782 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021458] [ENSMUST00000166101]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000021458
AA Change: V1513E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021458
Gene: ENSMUSG00000021061
AA Change: V1513E

Domain	Start	End	E-Value	Type
CH	56	156	2.73e-26	SMART
CH	175	273	4.57e-28	SMART
SPEC	305	411	2.71e0	SMART
SPEC	425	525	4.65e-23	SMART
SPEC	531	634	4.51e-21	SMART
SPEC	640	740	3.02e-31	SMART
SPEC	746	845	1.47e-20	SMART
SPEC	851	951	1.04e-20	SMART
SPEC	957	1058	7.22e-20	SMART
SPEC	1064	1165	2.06e-24	SMART
SPEC	1171	1271	3.84e-15	SMART
SPEC	1277	1376	2.22e-20	SMART
SPEC	1382	1475	5.04e-10	SMART
SPEC	1481	1581	3.58e-24	SMART
SPEC	1587	1687	4.11e-24	SMART
SPEC	1693	1794	2.91e-24	SMART
SPEC	1800	1900	7.8e-16	SMART
SPEC	1906	2006	3.16e-25	SMART
SPEC	2012	2193	4.32e-9	SMART
PH	2180	2291	8.98e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166101
AA Change: V1513E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129782
Gene: ENSMUSG00000021061
AA Change: V1513E

Domain	Start	End	E-Value	Type
CH	56	156	2.73e-26	SMART
CH	175	273	4.57e-28	SMART
SPEC	305	411	2.71e0	SMART
SPEC	425	525	4.65e-23	SMART
SPEC	531	634	4.51e-21	SMART
SPEC	640	740	3.02e-31	SMART
SPEC	746	845	1.47e-20	SMART
SPEC	851	951	1.04e-20	SMART
SPEC	957	1058	7.22e-20	SMART
SPEC	1064	1165	2.06e-24	SMART
SPEC	1171	1271	3.84e-15	SMART
SPEC	1277	1376	2.22e-20	SMART
SPEC	1382	1475	5.87e-11	SMART
SPEC	1481	1581	3.58e-24	SMART
SPEC	1587	1687	4.11e-24	SMART
SPEC	1693	1794	2.91e-24	SMART
SPEC	1800	1900	7.8e-16	SMART
SPEC	1906	2006	3.16e-25	SMART
SPEC	2012	2117	1.16e-9	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the spectrin gene family. Spectrin proteins, along with ankyrin, play a role in cell membrane organization and stability. The protein encoded by this locus functions in stability of erythrocyte membranes, and mutations in this gene have been associated with spherocytosis type 2, hereditary elliptocytosis, and neonatal hemolytic anemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit a severe microcytic anemia with erythrocyte fragility, hepatomegaly, and jaundice. Mutants die within a few days of birth. Heterozygotes are mildly anemic. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	A	6: 86,981,335	L800H	unknown	Het
Ap2b1	T	A	11: 83,389,726	D788E	probably damaging	Het
Arfgef1	T	C	1: 10,153,678	Q1465R	probably damaging	Het
Arfgef1	G	T	1: 10,153,679	Q1465K	probably damaging	Het
Arhgap9	G	A	10: 127,326,643	E348K	probably benign	Het
B4galnt2	A	T	11: 95,891,930	F19I	probably benign	Het
Bdp1	A	T	13: 100,074,531	I551N	probably damaging	Het
Ceacam16	A	G	7: 19,852,305	*427Q	probably null	Het
Chd9	A	C	8: 90,978,914	Q260P	probably benign	Het
Col16a1	A	T	4: 130,093,087		probably benign	Het
Csmd1	A	T	8: 17,216,789	N40K	possibly damaging	Het
Depdc5	T	G	5: 32,983,860	V1368G	probably damaging	Het
Dnah7b	C	A	1: 46,358,238	P3943Q	probably damaging	Het
Dnttip2	A	G	3: 122,282,492	Q691R	probably damaging	Het
Dusp10	T	C	1: 184,068,888	L284P	probably damaging	Het
Efr3b	A	G	12: 3,968,624	V574A	probably benign	Het
Erc2	A	T	14: 27,898,596	I60F	probably damaging	Het
Exoc2	A	G	13: 30,911,178	V245A	probably benign	Het
Fasl	G	T	1: 161,781,675	F37L	probably damaging	Het
Fat3	G	A	9: 16,029,916	P1360S	probably benign	Het
Gm12666	A	G	4: 92,191,589	I54T	probably damaging	Het
Gpsm1	C	T	2: 26,340,543	P502S	probably benign	Het
Gtpbp10	C	A	5: 5,555,331	G124V	probably damaging	Het
Insm2	T	C	12: 55,600,178	C236R	probably damaging	Het
Irf2bpl	A	G	12: 86,882,694	Y402H	possibly damaging	Het
Irx6	A	G	8: 92,677,330	E175G	probably damaging	Het
Kcnh8	C	T	17: 52,877,943	R418*	probably null	Het
Kif3c	G	A	12: 3,366,114	R45Q	probably benign	Het
Lpin1	A	G	12: 16,580,861	F12S	probably damaging	Het
Lrba	A	T	3: 86,619,590	T156S	probably benign	Het
Lrrc19	G	T	4: 94,639,373	N200K	probably benign	Het
Lrrc7	G	A	3: 158,156,913	H1296Y	probably benign	Het
Ltn1	A	T	16: 87,415,690	F661Y	probably damaging	Het
Macf1	T	C	4: 123,457,800	Y1893C	probably benign	Het
Mmd	G	C	11: 90,257,536	A15P	probably damaging	Het
Myh2	T	C	11: 67,197,266	F1903L	probably benign	Het
Myom3	T	C	4: 135,801,060	L1072P	probably damaging	Het
Olfr1350	G	A	7: 6,570,321	C110Y	probably damaging	Het
Olfr1402	A	T	3: 97,410,802	Y126*	probably null	Het
Olfr680-ps1	T	C	7: 105,091,256	I128V	probably benign	Het
Olfr855	A	T	9: 19,584,590	T18S	possibly damaging	Het
Patl2	A	T	2: 122,128,929	V18D	possibly damaging	Het
Pkn1	T	C	8: 83,683,426	S395G	probably damaging	Het
Ptprm	A	G	17: 66,912,418	I726T	possibly damaging	Het
Rab3gap2	T	C	1: 185,236,012	L187P	probably damaging	Het
Ric1	A	T	19: 29,585,782	E535V	probably damaging	Het
Ripor3	T	C	2: 167,985,737	K598R	probably benign	Het
Rnf40	A	G	7: 127,596,323	E607G	possibly damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Sbsn	A	G	7: 30,753,191	T544A	probably benign	Het
Scaf1	C	A	7: 45,007,829		probably benign	Het
Sec24a	T	C	11: 51,700,816	M1018V	probably benign	Het
Shmt1	C	T	11: 60,804,327	A54T	probably damaging	Het
Slc39a14	C	A	14: 70,308,826	V383F	probably damaging	Het
Slc5a2	A	G	7: 128,272,077	T346A	probably benign	Het
Slco4a1	G	A	2: 180,464,808	S261N	probably benign	Het
Smarcc1	C	G	9: 110,196,320	S688R	probably damaging	Het
Sppl2b	G	A	10: 80,865,125	A314T	probably damaging	Het
Stx17	A	T	4: 48,140,462	I56F	probably damaging	Het
Tbc1d9	A	G	8: 83,241,542	Y424C	probably damaging	Het
Tgm3	A	G	2: 130,042,029	K536E	probably benign	Het
Tti2	A	G	8: 31,154,301	I309V	possibly damaging	Het
Tymp	G	A	15: 89,374,048	S334L	probably benign	Het
Unc13b	T	C	4: 43,263,538	F1587L	possibly damaging	Het
Vgf	G	T	5: 137,031,653		probably benign	Het
Zfp59	T	C	7: 27,853,497	S125P	probably damaging	Het
Zfp641	A	T	15: 98,290,567	M144K	possibly damaging	Het
Zfp93	A	T	7: 24,275,381	K264*	probably null	Het

Other mutations in Sptb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Sptb	APN	12	76621331	missense	probably benign	0.00
IGL00160:Sptb	APN	12	76623169	missense	probably damaging	1.00
IGL00229:Sptb	APN	12	76620753	missense	probably benign	0.20
IGL00820:Sptb	APN	12	76632477	missense	probably damaging	1.00
IGL01309:Sptb	APN	12	76587463	missense	probably benign	0.16
IGL01408:Sptb	APN	12	76613147	missense	possibly damaging	0.93
IGL01450:Sptb	APN	12	76624240	missense	possibly damaging	0.89
IGL01455:Sptb	APN	12	76612912	missense	probably damaging	1.00
IGL01457:Sptb	APN	12	76612555	splice site	probably benign
IGL01680:Sptb	APN	12	76630682	missense	probably damaging	1.00
IGL02070:Sptb	APN	12	76605539	missense	possibly damaging	0.82
IGL02346:Sptb	APN	12	76621014	missense	probably damaging	1.00
IGL02452:Sptb	APN	12	76609036	critical splice donor site	probably null
IGL02515:Sptb	APN	12	76606487	missense	possibly damaging	0.51
IGL02545:Sptb	APN	12	76607980	critical splice donor site	probably null
IGL02644:Sptb	APN	12	76605617	missense	probably damaging	1.00
IGL02878:Sptb	APN	12	76620753	missense	probably benign	0.20
IGL03007:Sptb	APN	12	76621341	missense	probably damaging	1.00
IGL03220:Sptb	APN	12	76612910	missense	probably benign	0.06
IGL03343:Sptb	APN	12	76583556	unclassified	probably benign
IGL03098:Sptb	UTSW	12	76621499	missense	probably damaging	1.00
PIT4472001:Sptb	UTSW	12	76620686	missense	probably damaging	1.00
R0047:Sptb	UTSW	12	76622950	missense	probably damaging	0.99
R0365:Sptb	UTSW	12	76600383	missense	probably benign	0.12
R0373:Sptb	UTSW	12	76621371	missense	probably benign	0.03
R0704:Sptb	UTSW	12	76583594	missense	probably damaging	0.99
R1005:Sptb	UTSW	12	76601859	critical splice donor site	probably null
R1109:Sptb	UTSW	12	76603603	missense	probably damaging	1.00
R1264:Sptb	UTSW	12	76612607	missense	probably damaging	1.00
R1358:Sptb	UTSW	12	76621321	frame shift	probably null
R1358:Sptb	UTSW	12	76621326	missense	probably damaging	1.00
R1459:Sptb	UTSW	12	76611883	missense	probably benign	0.01
R1518:Sptb	UTSW	12	76604024	missense	possibly damaging	0.95
R1628:Sptb	UTSW	12	76583848	missense	probably damaging	1.00
R1668:Sptb	UTSW	12	76621169	missense	probably benign
R1677:Sptb	UTSW	12	76629649	missense	probably damaging	1.00
R1687:Sptb	UTSW	12	76603699	missense	possibly damaging	0.95
R1695:Sptb	UTSW	12	76620867	missense	probably benign	0.10
R1708:Sptb	UTSW	12	76612574	missense	probably damaging	1.00
R1761:Sptb	UTSW	12	76612608	missense	probably damaging	0.96
R1925:Sptb	UTSW	12	76622253	missense	probably damaging	1.00
R2011:Sptb	UTSW	12	76632472	missense	possibly damaging	0.95
R2373:Sptb	UTSW	12	76621161	missense	probably damaging	1.00
R2517:Sptb	UTSW	12	76649869	missense	possibly damaging	0.55
R2918:Sptb	UTSW	12	76598758	missense	probably damaging	0.97
R2961:Sptb	UTSW	12	76603582	missense	probably benign	0.19
R3409:Sptb	UTSW	12	76610815	missense	possibly damaging	0.78
R3410:Sptb	UTSW	12	76610815	missense	possibly damaging	0.78
R3411:Sptb	UTSW	12	76610815	missense	possibly damaging	0.78
R3744:Sptb	UTSW	12	76600400	missense	probably benign
R4112:Sptb	UTSW	12	76597779	missense	probably damaging	0.99
R4177:Sptb	UTSW	12	76613179	missense	probably benign	0.25
R4194:Sptb	UTSW	12	76613010	missense	probably benign	0.44
R4301:Sptb	UTSW	12	76612697	missense	probably damaging	1.00
R4555:Sptb	UTSW	12	76612851	missense	probably benign	0.03
R4619:Sptb	UTSW	12	76583807	nonsense	probably null
R4620:Sptb	UTSW	12	76583807	nonsense	probably null
R4625:Sptb	UTSW	12	76587326	splice site	probably null
R4728:Sptb	UTSW	12	76583379	missense	probably benign	0.00
R4751:Sptb	UTSW	12	76627110	missense	probably benign	0.07
R4810:Sptb	UTSW	12	76623197	nonsense	probably null
R4888:Sptb	UTSW	12	76609037	missense	probably benign	0.00
R4894:Sptb	UTSW	12	76624994	critical splice donor site	probably null
R5114:Sptb	UTSW	12	76609278	missense	probably damaging	1.00
R5191:Sptb	UTSW	12	76612834	missense	probably benign	0.12
R5479:Sptb	UTSW	12	76599851	missense	probably benign	0.04
R5646:Sptb	UTSW	12	76587441	missense	probably benign
R5725:Sptb	UTSW	12	76623114	missense	probably benign	0.25
R5727:Sptb	UTSW	12	76623114	missense	probably benign	0.25
R5797:Sptb	UTSW	12	76603699	missense	possibly damaging	0.95
R5874:Sptb	UTSW	12	76598727	missense	possibly damaging	0.91
R5952:Sptb	UTSW	12	76632384	missense	probably benign	0.02
R5956:Sptb	UTSW	12	76604168	missense	probably benign
R6298:Sptb	UTSW	12	76620654	critical splice donor site	probably null
R6470:Sptb	UTSW	12	76612829	missense	probably damaging	1.00
R6477:Sptb	UTSW	12	76606392	missense	probably damaging	1.00
R6736:Sptb	UTSW	12	76613180	missense	possibly damaging	0.49
R6854:Sptb	UTSW	12	76603480	missense	probably damaging	1.00
R6987:Sptb	UTSW	12	76613247	missense	probably benign	0.00
R7023:Sptb	UTSW	12	76625088	missense	probably damaging	1.00
R7366:Sptb	UTSW	12	76604194	missense	probably damaging	1.00
R7379:Sptb	UTSW	12	76610877	missense	probably damaging	1.00
R7389:Sptb	UTSW	12	76624229	missense	probably damaging	0.98
R7392:Sptb	UTSW	12	76624229	missense	probably damaging	0.98
R7477:Sptb	UTSW	12	76628565	missense	probably damaging	1.00
R7653:Sptb	UTSW	12	76628497	missense	probably benign	0.06
R7684:Sptb	UTSW	12	76612195	missense	probably benign	0.06
R7733:Sptb	UTSW	12	76597921	splice site	probably null
R7846:Sptb	UTSW	12	76608526	nonsense	probably null
R8048:Sptb	UTSW	12	76628559	missense	probably benign	0.02
R8261:Sptb	UTSW	12	76621262	missense	probably benign	0.06
R8324:Sptb	UTSW	12	76619162	missense	possibly damaging	0.73
R8512:Sptb	UTSW	12	76602052	missense	possibly damaging	0.51
R8515:Sptb	UTSW	12	76612041	missense	probably benign	0.10
R8558:Sptb	UTSW	12	76612787	missense	probably benign	0.09
R8872:Sptb	UTSW	12	76612039	missense	probably benign	0.37
R8907:Sptb	UTSW	12	76587412	missense	probably benign	0.16
R9047:Sptb	UTSW	12	76632534	splice site	probably benign
R9079:Sptb	UTSW	12	76630680	missense	probably damaging	1.00
R9166:Sptb	UTSW	12	76627002	missense	probably damaging	0.96
R9381:Sptb	UTSW	12	76587518	missense	probably benign
R9601:Sptb	UTSW	12	76620989	missense	probably damaging	1.00
R9680:Sptb	UTSW	12	76630715	missense	probably damaging	1.00
R9771:Sptb	UTSW	12	76603579	missense	probably damaging	1.00
X0057:Sptb	UTSW	12	76630739	missense	probably benign
Z1176:Sptb	UTSW	12	76620733	nonsense	probably null
Z1177:Sptb	UTSW	12	76583584	missense	probably damaging	1.00
Z1177:Sptb	UTSW	12	76606445	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- TAAGTAGCAGGATGCCCAGC -3'
(R):5'- CCACTATGGGATCAGGAACAGG -3'

Sequencing Primer
(F):5'- CCACTTTCTGCATTGAAATTTCAG -3'
(R):5'- GGAACCTCAGTTTGAAATACCTGTC -3'

Posted On

2018-11-28