Incidental Mutation 'R6969:Irf2bpl'
ID 543406
Institutional Source Beutler Lab
Gene Symbol Irf2bpl
Ensembl Gene ENSMUSG00000034168
Gene Name interferon regulatory factor 2 binding protein-like
Synonyms 6430527G18Rik
MMRRC Submission 045079-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.381) question?
Stock # R6969 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 86927475-86931572 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86929468 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 402 (Y402H)
Ref Sequence ENSEMBL: ENSMUSP00000041070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038422]
AlphaFold Q8K3X4
Predicted Effect possibly damaging
Transcript: ENSMUST00000038422
AA Change: Y402H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041070
Gene: ENSMUSG00000034168
AA Change: Y402H

DomainStartEndE-ValueType
Pfam:IRF-2BP1_2 10 61 2e-38 PFAM
low complexity region 70 78 N/A INTRINSIC
coiled coil region 84 113 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 214 234 N/A INTRINSIC
low complexity region 258 300 N/A INTRINSIC
coiled coil region 314 350 N/A INTRINSIC
low complexity region 496 519 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 627 646 N/A INTRINSIC
PDB:2CS3|A 684 765 7e-52 PDB
SCOP:d1fbva4 692 738 4e-6 SMART
Blast:RING 694 745 4e-24 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that may play a role in regulating female reproductive function. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,958,317 (GRCm39) L800H unknown Het
Ap2b1 T A 11: 83,280,552 (GRCm39) D788E probably damaging Het
Arfgef1 G T 1: 10,223,904 (GRCm39) Q1465K probably damaging Het
Arfgef1 T C 1: 10,223,903 (GRCm39) Q1465R probably damaging Het
Arhgap9 G A 10: 127,162,512 (GRCm39) E348K probably benign Het
B4galnt2 A T 11: 95,782,756 (GRCm39) F19I probably benign Het
Bdp1 A T 13: 100,211,039 (GRCm39) I551N probably damaging Het
Ceacam16 A G 7: 19,586,230 (GRCm39) *427Q probably null Het
Chd9 A C 8: 91,705,542 (GRCm39) Q260P probably benign Het
Col16a1 A T 4: 129,986,880 (GRCm39) probably benign Het
Csmd1 A T 8: 17,266,805 (GRCm39) N40K possibly damaging Het
Depdc5 T G 5: 33,141,204 (GRCm39) V1368G probably damaging Het
Dnah7b C A 1: 46,397,398 (GRCm39) P3943Q probably damaging Het
Dnttip2 A G 3: 122,076,141 (GRCm39) Q691R probably damaging Het
Dusp10 T C 1: 183,801,085 (GRCm39) L284P probably damaging Het
Efr3b A G 12: 4,018,624 (GRCm39) V574A probably benign Het
Erc2 A T 14: 27,620,553 (GRCm39) I60F probably damaging Het
Exoc2 A G 13: 31,095,161 (GRCm39) V245A probably benign Het
Fasl G T 1: 161,609,244 (GRCm39) F37L probably damaging Het
Fat3 G A 9: 15,941,212 (GRCm39) P1360S probably benign Het
Gpsm1 C T 2: 26,230,555 (GRCm39) P502S probably benign Het
Gtpbp10 C A 5: 5,605,331 (GRCm39) G124V probably damaging Het
Insm2 T C 12: 55,646,963 (GRCm39) C236R probably damaging Het
Irx6 A G 8: 93,403,958 (GRCm39) E175G probably damaging Het
Kcnh8 C T 17: 53,184,971 (GRCm39) R418* probably null Het
Kif3c G A 12: 3,416,114 (GRCm39) R45Q probably benign Het
Larp7-ps A G 4: 92,079,826 (GRCm39) I54T probably damaging Het
Lpin1 A G 12: 16,630,862 (GRCm39) F12S probably damaging Het
Lrba A T 3: 86,526,897 (GRCm39) T156S probably benign Het
Lrrc19 G T 4: 94,527,610 (GRCm39) N200K probably benign Het
Lrrc7 G A 3: 157,862,550 (GRCm39) H1296Y probably benign Het
Ltn1 A T 16: 87,212,578 (GRCm39) F661Y probably damaging Het
Macf1 T C 4: 123,351,593 (GRCm39) Y1893C probably benign Het
Mmd G C 11: 90,148,362 (GRCm39) A15P probably damaging Het
Myh2 T C 11: 67,088,092 (GRCm39) F1903L probably benign Het
Myom3 T C 4: 135,528,371 (GRCm39) L1072P probably damaging Het
Or13l2 A T 3: 97,318,118 (GRCm39) Y126* probably null Het
Or56a41 T C 7: 104,740,463 (GRCm39) I128V probably benign Het
Or5bw2 G A 7: 6,573,320 (GRCm39) C110Y probably damaging Het
Or7g35 A T 9: 19,495,886 (GRCm39) T18S possibly damaging Het
Patl2 A T 2: 121,959,410 (GRCm39) V18D possibly damaging Het
Pkn1 T C 8: 84,410,055 (GRCm39) S395G probably damaging Het
Ptprm A G 17: 67,219,413 (GRCm39) I726T possibly damaging Het
Rab3gap2 T C 1: 184,968,209 (GRCm39) L187P probably damaging Het
Ric1 A T 19: 29,563,182 (GRCm39) E535V probably damaging Het
Ripor3 T C 2: 167,827,657 (GRCm39) K598R probably benign Het
Rnf40 A G 7: 127,195,495 (GRCm39) E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sbsn A G 7: 30,452,616 (GRCm39) T544A probably benign Het
Scaf1 C A 7: 44,657,253 (GRCm39) probably benign Het
Sec24a T C 11: 51,591,643 (GRCm39) M1018V probably benign Het
Shmt1 C T 11: 60,695,153 (GRCm39) A54T probably damaging Het
Slc39a14 C A 14: 70,546,275 (GRCm39) V383F probably damaging Het
Slc5a2 A G 7: 127,871,249 (GRCm39) T346A probably benign Het
Slco4a1 G A 2: 180,106,601 (GRCm39) S261N probably benign Het
Smarcc1 C G 9: 110,025,388 (GRCm39) S688R probably damaging Het
Sppl2b G A 10: 80,700,959 (GRCm39) A314T probably damaging Het
Sptb A T 12: 76,654,781 (GRCm39) V1513E probably damaging Het
Stx17 A T 4: 48,140,462 (GRCm39) I56F probably damaging Het
Tbc1d9 A G 8: 83,968,171 (GRCm39) Y424C probably damaging Het
Tgm3 A G 2: 129,883,949 (GRCm39) K536E probably benign Het
Tti2 A G 8: 31,644,329 (GRCm39) I309V possibly damaging Het
Tymp G A 15: 89,258,251 (GRCm39) S334L probably benign Het
Unc13b T C 4: 43,263,538 (GRCm39) F1587L possibly damaging Het
Vgf G T 5: 137,060,507 (GRCm39) probably benign Het
Zfp59 T C 7: 27,552,922 (GRCm39) S125P probably damaging Het
Zfp641 A T 15: 98,188,448 (GRCm39) M144K possibly damaging Het
Zfp93 A T 7: 23,974,806 (GRCm39) K264* probably null Het
Other mutations in Irf2bpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03343:Irf2bpl APN 12 86,929,713 (GRCm39) missense possibly damaging 0.72
twig UTSW 12 86,930,238 (GRCm39) missense probably benign 0.01
PIT1430001:Irf2bpl UTSW 12 86,930,229 (GRCm39) missense possibly damaging 0.91
R0218:Irf2bpl UTSW 12 86,929,398 (GRCm39) missense probably benign 0.02
R0371:Irf2bpl UTSW 12 86,928,417 (GRCm39) nonsense probably null
R0426:Irf2bpl UTSW 12 86,929,870 (GRCm39) missense probably benign 0.06
R1351:Irf2bpl UTSW 12 86,929,398 (GRCm39) missense probably benign 0.02
R2881:Irf2bpl UTSW 12 86,929,551 (GRCm39) missense probably damaging 0.98
R3610:Irf2bpl UTSW 12 86,928,631 (GRCm39) missense probably benign 0.03
R4206:Irf2bpl UTSW 12 86,929,810 (GRCm39) missense probably benign 0.00
R4240:Irf2bpl UTSW 12 86,929,691 (GRCm39) missense possibly damaging 0.73
R4938:Irf2bpl UTSW 12 86,928,892 (GRCm39) missense possibly damaging 0.73
R5451:Irf2bpl UTSW 12 86,928,846 (GRCm39) missense probably benign 0.33
R6213:Irf2bpl UTSW 12 86,930,367 (GRCm39) missense probably benign 0.18
R6491:Irf2bpl UTSW 12 86,930,238 (GRCm39) missense probably benign 0.01
R7151:Irf2bpl UTSW 12 86,930,127 (GRCm39) missense probably benign 0.00
R7649:Irf2bpl UTSW 12 86,929,572 (GRCm39) missense possibly damaging 0.96
R7751:Irf2bpl UTSW 12 86,930,489 (GRCm39) missense probably damaging 0.99
R8711:Irf2bpl UTSW 12 86,928,496 (GRCm39) missense probably benign 0.03
R8857:Irf2bpl UTSW 12 86,929,359 (GRCm39) missense possibly damaging 0.96
X0066:Irf2bpl UTSW 12 86,928,424 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TCCTTGAAGAAGCGCACAG -3'
(R):5'- GTGTGTCAGCCACTGTATCC -3'

Sequencing Primer
(F):5'- ACTTGAAGCCAGAGGACA -3'
(R):5'- AAGAGGCCTGGATCGGTGTC -3'
Posted On 2018-11-28