Incidental Mutation 'R6969:Exoc2'
ID 543407
Institutional Source Beutler Lab
Gene Symbol Exoc2
Ensembl Gene ENSMUSG00000021357
Gene Name exocyst complex component 2
Synonyms 2410030I24Rik, Sec5l1, Sec5, Gm29675
MMRRC Submission 045079-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R6969 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 30972939-31162082 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31095161 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 245 (V245A)
Ref Sequence ENSEMBL: ENSMUSP00000100010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]
AlphaFold Q9D4H1
Predicted Effect probably benign
Transcript: ENSMUST00000021785
AA Change: V245A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: V245A

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102946
AA Change: V245A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: V245A

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,958,317 (GRCm39) L800H unknown Het
Ap2b1 T A 11: 83,280,552 (GRCm39) D788E probably damaging Het
Arfgef1 G T 1: 10,223,904 (GRCm39) Q1465K probably damaging Het
Arfgef1 T C 1: 10,223,903 (GRCm39) Q1465R probably damaging Het
Arhgap9 G A 10: 127,162,512 (GRCm39) E348K probably benign Het
B4galnt2 A T 11: 95,782,756 (GRCm39) F19I probably benign Het
Bdp1 A T 13: 100,211,039 (GRCm39) I551N probably damaging Het
Ceacam16 A G 7: 19,586,230 (GRCm39) *427Q probably null Het
Chd9 A C 8: 91,705,542 (GRCm39) Q260P probably benign Het
Col16a1 A T 4: 129,986,880 (GRCm39) probably benign Het
Csmd1 A T 8: 17,266,805 (GRCm39) N40K possibly damaging Het
Depdc5 T G 5: 33,141,204 (GRCm39) V1368G probably damaging Het
Dnah7b C A 1: 46,397,398 (GRCm39) P3943Q probably damaging Het
Dnttip2 A G 3: 122,076,141 (GRCm39) Q691R probably damaging Het
Dusp10 T C 1: 183,801,085 (GRCm39) L284P probably damaging Het
Efr3b A G 12: 4,018,624 (GRCm39) V574A probably benign Het
Erc2 A T 14: 27,620,553 (GRCm39) I60F probably damaging Het
Fasl G T 1: 161,609,244 (GRCm39) F37L probably damaging Het
Fat3 G A 9: 15,941,212 (GRCm39) P1360S probably benign Het
Gpsm1 C T 2: 26,230,555 (GRCm39) P502S probably benign Het
Gtpbp10 C A 5: 5,605,331 (GRCm39) G124V probably damaging Het
Insm2 T C 12: 55,646,963 (GRCm39) C236R probably damaging Het
Irf2bpl A G 12: 86,929,468 (GRCm39) Y402H possibly damaging Het
Irx6 A G 8: 93,403,958 (GRCm39) E175G probably damaging Het
Kcnh8 C T 17: 53,184,971 (GRCm39) R418* probably null Het
Kif3c G A 12: 3,416,114 (GRCm39) R45Q probably benign Het
Larp7-ps A G 4: 92,079,826 (GRCm39) I54T probably damaging Het
Lpin1 A G 12: 16,630,862 (GRCm39) F12S probably damaging Het
Lrba A T 3: 86,526,897 (GRCm39) T156S probably benign Het
Lrrc19 G T 4: 94,527,610 (GRCm39) N200K probably benign Het
Lrrc7 G A 3: 157,862,550 (GRCm39) H1296Y probably benign Het
Ltn1 A T 16: 87,212,578 (GRCm39) F661Y probably damaging Het
Macf1 T C 4: 123,351,593 (GRCm39) Y1893C probably benign Het
Mmd G C 11: 90,148,362 (GRCm39) A15P probably damaging Het
Myh2 T C 11: 67,088,092 (GRCm39) F1903L probably benign Het
Myom3 T C 4: 135,528,371 (GRCm39) L1072P probably damaging Het
Or13l2 A T 3: 97,318,118 (GRCm39) Y126* probably null Het
Or56a41 T C 7: 104,740,463 (GRCm39) I128V probably benign Het
Or5bw2 G A 7: 6,573,320 (GRCm39) C110Y probably damaging Het
Or7g35 A T 9: 19,495,886 (GRCm39) T18S possibly damaging Het
Patl2 A T 2: 121,959,410 (GRCm39) V18D possibly damaging Het
Pkn1 T C 8: 84,410,055 (GRCm39) S395G probably damaging Het
Ptprm A G 17: 67,219,413 (GRCm39) I726T possibly damaging Het
Rab3gap2 T C 1: 184,968,209 (GRCm39) L187P probably damaging Het
Ric1 A T 19: 29,563,182 (GRCm39) E535V probably damaging Het
Ripor3 T C 2: 167,827,657 (GRCm39) K598R probably benign Het
Rnf40 A G 7: 127,195,495 (GRCm39) E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Sbsn A G 7: 30,452,616 (GRCm39) T544A probably benign Het
Scaf1 C A 7: 44,657,253 (GRCm39) probably benign Het
Sec24a T C 11: 51,591,643 (GRCm39) M1018V probably benign Het
Shmt1 C T 11: 60,695,153 (GRCm39) A54T probably damaging Het
Slc39a14 C A 14: 70,546,275 (GRCm39) V383F probably damaging Het
Slc5a2 A G 7: 127,871,249 (GRCm39) T346A probably benign Het
Slco4a1 G A 2: 180,106,601 (GRCm39) S261N probably benign Het
Smarcc1 C G 9: 110,025,388 (GRCm39) S688R probably damaging Het
Sppl2b G A 10: 80,700,959 (GRCm39) A314T probably damaging Het
Sptb A T 12: 76,654,781 (GRCm39) V1513E probably damaging Het
Stx17 A T 4: 48,140,462 (GRCm39) I56F probably damaging Het
Tbc1d9 A G 8: 83,968,171 (GRCm39) Y424C probably damaging Het
Tgm3 A G 2: 129,883,949 (GRCm39) K536E probably benign Het
Tti2 A G 8: 31,644,329 (GRCm39) I309V possibly damaging Het
Tymp G A 15: 89,258,251 (GRCm39) S334L probably benign Het
Unc13b T C 4: 43,263,538 (GRCm39) F1587L possibly damaging Het
Vgf G T 5: 137,060,507 (GRCm39) probably benign Het
Zfp59 T C 7: 27,552,922 (GRCm39) S125P probably damaging Het
Zfp641 A T 15: 98,188,448 (GRCm39) M144K possibly damaging Het
Zfp93 A T 7: 23,974,806 (GRCm39) K264* probably null Het
Other mutations in Exoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Exoc2 APN 13 31,004,609 (GRCm39) missense probably benign 0.17
IGL01839:Exoc2 APN 13 31,090,782 (GRCm39) missense probably damaging 1.00
IGL02092:Exoc2 APN 13 31,059,260 (GRCm39) missense probably benign 0.09
IGL02245:Exoc2 APN 13 31,090,842 (GRCm39) missense probably benign 0.10
IGL02267:Exoc2 APN 13 30,999,304 (GRCm39) missense probably benign
IGL02478:Exoc2 APN 13 31,111,403 (GRCm39) missense probably benign
IGL02500:Exoc2 APN 13 31,095,179 (GRCm39) missense probably damaging 1.00
IGL03081:Exoc2 APN 13 31,084,885 (GRCm39) missense probably benign 0.28
IGL03112:Exoc2 APN 13 31,090,570 (GRCm39) splice site probably benign
IGL03409:Exoc2 APN 13 31,124,720 (GRCm39) utr 5 prime probably benign
R0284:Exoc2 UTSW 13 31,061,608 (GRCm39) splice site probably benign
R0452:Exoc2 UTSW 13 31,070,310 (GRCm39) splice site probably benign
R0826:Exoc2 UTSW 13 31,040,780 (GRCm39) critical splice acceptor site probably null
R1251:Exoc2 UTSW 13 31,070,259 (GRCm39) missense probably benign 0.03
R1367:Exoc2 UTSW 13 31,066,256 (GRCm39) nonsense probably null
R1501:Exoc2 UTSW 13 31,119,485 (GRCm39) missense probably benign 0.01
R1593:Exoc2 UTSW 13 31,040,744 (GRCm39) missense possibly damaging 0.64
R1839:Exoc2 UTSW 13 31,090,480 (GRCm39) splice site probably benign
R1872:Exoc2 UTSW 13 31,006,644 (GRCm39) missense probably benign 0.17
R2064:Exoc2 UTSW 13 31,119,544 (GRCm39) missense probably benign 0.00
R2070:Exoc2 UTSW 13 30,999,353 (GRCm39) missense probably benign 0.00
R2227:Exoc2 UTSW 13 31,048,867 (GRCm39) missense probably benign
R2507:Exoc2 UTSW 13 31,066,348 (GRCm39) missense possibly damaging 0.55
R3965:Exoc2 UTSW 13 31,061,565 (GRCm39) missense probably benign 0.00
R4601:Exoc2 UTSW 13 31,066,251 (GRCm39) missense probably benign 0.05
R4914:Exoc2 UTSW 13 31,060,796 (GRCm39) missense probably benign 0.21
R5299:Exoc2 UTSW 13 31,055,901 (GRCm39) splice site probably null
R5410:Exoc2 UTSW 13 31,048,839 (GRCm39) missense probably damaging 0.98
R5461:Exoc2 UTSW 13 31,109,738 (GRCm39) missense possibly damaging 0.66
R5956:Exoc2 UTSW 13 31,004,606 (GRCm39) missense probably benign 0.03
R6056:Exoc2 UTSW 13 31,084,812 (GRCm39) missense probably benign 0.03
R6107:Exoc2 UTSW 13 31,060,780 (GRCm39) missense probably benign
R6548:Exoc2 UTSW 13 31,010,047 (GRCm39) missense possibly damaging 0.86
R6692:Exoc2 UTSW 13 31,119,490 (GRCm39) missense probably benign 0.09
R7386:Exoc2 UTSW 13 31,090,646 (GRCm39) splice site probably null
R7461:Exoc2 UTSW 13 31,066,255 (GRCm39) missense probably benign 0.32
R7467:Exoc2 UTSW 13 31,109,716 (GRCm39) missense probably damaging 0.98
R7473:Exoc2 UTSW 13 31,006,613 (GRCm39) critical splice donor site probably null
R7613:Exoc2 UTSW 13 31,066,255 (GRCm39) missense probably benign 0.32
R7767:Exoc2 UTSW 13 31,060,752 (GRCm39) missense probably benign 0.01
R7793:Exoc2 UTSW 13 31,095,161 (GRCm39) missense probably benign 0.00
R7795:Exoc2 UTSW 13 31,060,756 (GRCm39) nonsense probably null
R7993:Exoc2 UTSW 13 31,090,713 (GRCm39) critical splice donor site probably null
R8085:Exoc2 UTSW 13 31,124,686 (GRCm39) missense probably damaging 1.00
R8330:Exoc2 UTSW 13 31,061,556 (GRCm39) missense probably benign
R8716:Exoc2 UTSW 13 31,095,227 (GRCm39) missense probably damaging 1.00
R8735:Exoc2 UTSW 13 31,090,822 (GRCm39) missense probably damaging 1.00
R8922:Exoc2 UTSW 13 31,055,838 (GRCm39) missense probably benign 0.05
R9237:Exoc2 UTSW 13 31,048,858 (GRCm39) missense probably benign
R9243:Exoc2 UTSW 13 31,109,778 (GRCm39) missense probably benign 0.03
R9365:Exoc2 UTSW 13 31,040,697 (GRCm39) missense probably benign 0.00
R9731:Exoc2 UTSW 13 31,061,233 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCAGGTAGCAAATTACAGTTCTTGAG -3'
(R):5'- CATCTGTGTTTTCCCAGAATGTTG -3'

Sequencing Primer
(F):5'- AGTCGTTACCAAGCCCTT -3'
(R):5'- TCCTCTTGAATGGTGAAAATAATAGG -3'
Posted On 2018-11-28