Mutagenetix > Incidental Mutations

Incidental Mutation 'R6969:Bdp1'

543408

Institutional Source

Beutler Lab

Gene Symbol

Bdp1

Ensembl Gene

ENSMUSG00000049658

Gene Name

B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB

Synonyms

TAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6969 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

100017994-100104070 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 100074531 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 551 (I551N)

Ref Sequence

ENSEMBL: ENSMUSP00000105005 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038104
AA Change: I551N

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: I551N

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	375	399	N/A	INTRINSIC
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	3.56e-18	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	3.56e-18	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109379
AA Change: I551N

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: I551N

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	4.79e-19	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	4.79e-19	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	A	6: 86,981,335	L800H	unknown	Het
Ap2b1	T	A	11: 83,389,726	D788E	probably damaging	Het
Arfgef1	T	C	1: 10,153,678	Q1465R	probably damaging	Het
Arfgef1	G	T	1: 10,153,679	Q1465K	probably damaging	Het
Arhgap9	G	A	10: 127,326,643	E348K	probably benign	Het
B4galnt2	A	T	11: 95,891,930	F19I	probably benign	Het
Ceacam16	A	G	7: 19,852,305	*427Q	probably null	Het
Chd9	A	C	8: 90,978,914	Q260P	probably benign	Het
Col16a1	A	T	4: 130,093,087		probably benign	Het
Csmd1	A	T	8: 17,216,789	N40K	possibly damaging	Het
Depdc5	T	G	5: 32,983,860	V1368G	probably damaging	Het
Dnah7b	C	A	1: 46,358,238	P3943Q	probably damaging	Het
Dnttip2	A	G	3: 122,282,492	Q691R	probably damaging	Het
Dusp10	T	C	1: 184,068,888	L284P	probably damaging	Het
Efr3b	A	G	12: 3,968,624	V574A	probably benign	Het
Erc2	A	T	14: 27,898,596	I60F	probably damaging	Het
Exoc2	A	G	13: 30,911,178	V245A	probably benign	Het
Fasl	G	T	1: 161,781,675	F37L	probably damaging	Het
Fat3	G	A	9: 16,029,916	P1360S	probably benign	Het
Gm12666	A	G	4: 92,191,589	I54T	probably damaging	Het
Gpsm1	C	T	2: 26,340,543	P502S	probably benign	Het
Gtpbp10	C	A	5: 5,555,331	G124V	probably damaging	Het
Insm2	T	C	12: 55,600,178	C236R	probably damaging	Het
Irf2bpl	A	G	12: 86,882,694	Y402H	possibly damaging	Het
Irx6	A	G	8: 92,677,330	E175G	probably damaging	Het
Kcnh8	C	T	17: 52,877,943	R418*	probably null	Het
Kif3c	G	A	12: 3,366,114	R45Q	probably benign	Het
Lpin1	A	G	12: 16,580,861	F12S	probably damaging	Het
Lrba	A	T	3: 86,619,590	T156S	probably benign	Het
Lrrc19	G	T	4: 94,639,373	N200K	probably benign	Het
Lrrc7	G	A	3: 158,156,913	H1296Y	probably benign	Het
Ltn1	A	T	16: 87,415,690	F661Y	probably damaging	Het
Macf1	T	C	4: 123,457,800	Y1893C	probably benign	Het
Mmd	G	C	11: 90,257,536	A15P	probably damaging	Het
Myh2	T	C	11: 67,197,266	F1903L	probably benign	Het
Myom3	T	C	4: 135,801,060	L1072P	probably damaging	Het
Olfr1350	G	A	7: 6,570,321	C110Y	probably damaging	Het
Olfr1402	A	T	3: 97,410,802	Y126*	probably null	Het
Olfr680-ps1	T	C	7: 105,091,256	I128V	probably benign	Het
Olfr855	A	T	9: 19,584,590	T18S	possibly damaging	Het
Patl2	A	T	2: 122,128,929	V18D	possibly damaging	Het
Pkn1	T	C	8: 83,683,426	S395G	probably damaging	Het
Ptprm	A	G	17: 66,912,418	I726T	possibly damaging	Het
Rab3gap2	T	C	1: 185,236,012	L187P	probably damaging	Het
Ric1	A	T	19: 29,585,782	E535V	probably damaging	Het
Ripor3	T	C	2: 167,985,737	K598R	probably benign	Het
Rnf40	A	G	7: 127,596,323	E607G	possibly damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Sbsn	A	G	7: 30,753,191	T544A	probably benign	Het
Scaf1	C	A	7: 45,007,829		probably benign	Het
Sec24a	T	C	11: 51,700,816	M1018V	probably benign	Het
Shmt1	C	T	11: 60,804,327	A54T	probably damaging	Het
Slc39a14	C	A	14: 70,308,826	V383F	probably damaging	Het
Slc5a2	A	G	7: 128,272,077	T346A	probably benign	Het
Slco4a1	G	A	2: 180,464,808	S261N	probably benign	Het
Smarcc1	C	G	9: 110,196,320	S688R	probably damaging	Het
Sppl2b	G	A	10: 80,865,125	A314T	probably damaging	Het
Sptb	A	T	12: 76,608,007	V1513E	probably damaging	Het
Stx17	A	T	4: 48,140,462	I56F	probably damaging	Het
Tbc1d9	A	G	8: 83,241,542	Y424C	probably damaging	Het
Tgm3	A	G	2: 130,042,029	K536E	probably benign	Het
Tti2	A	G	8: 31,154,301	I309V	possibly damaging	Het
Tymp	G	A	15: 89,374,048	S334L	probably benign	Het
Unc13b	T	C	4: 43,263,538	F1587L	possibly damaging	Het
Vgf	G	T	5: 137,031,653		probably benign	Het
Zfp59	T	C	7: 27,853,497	S125P	probably damaging	Het
Zfp641	A	T	15: 98,290,567	M144K	possibly damaging	Het
Zfp93	A	T	7: 24,275,381	K264*	probably null	Het

Other mutations in Bdp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Bdp1	APN	13	100098510	missense	probably damaging	1.00
IGL00096:Bdp1	APN	13	100060865	missense	possibly damaging	0.61
IGL00160:Bdp1	APN	13	100061198	missense	probably benign	0.00
IGL00924:Bdp1	APN	13	100097579	missense	possibly damaging	0.89
IGL01337:Bdp1	APN	13	100056192	missense	probably benign	0.00
IGL01344:Bdp1	APN	13	100078080	missense	probably benign	0.06
IGL01347:Bdp1	APN	13	100070203	missense	possibly damaging	0.79
IGL01620:Bdp1	APN	13	100084205	splice site	probably benign
IGL01871:Bdp1	APN	13	100066053	missense	probably benign	0.01
IGL02008:Bdp1	APN	13	100023827	missense	possibly damaging	0.92
IGL02112:Bdp1	APN	13	100037800	missense	probably benign	0.02
IGL02214:Bdp1	APN	13	100041535	missense	probably benign	0.00
IGL02236:Bdp1	APN	13	100060891	missense	probably benign
IGL02307:Bdp1	APN	13	100093438	missense	probably damaging	1.00
IGL02364:Bdp1	APN	13	100055308	splice site	probably benign
IGL02415:Bdp1	APN	13	100089408	missense	probably damaging	0.96
IGL02601:Bdp1	APN	13	100098514	missense	possibly damaging	0.72
IGL02605:Bdp1	APN	13	100078115	critical splice acceptor site	probably null
IGL02664:Bdp1	APN	13	100051539	missense	probably benign	0.29
IGL02738:Bdp1	APN	13	100051353	missense	probably benign	0.26
IGL02754:Bdp1	APN	13	100060973	missense	possibly damaging	0.94
IGL02967:Bdp1	APN	13	100042270	missense	possibly damaging	0.92
IGL02974:Bdp1	APN	13	100055292	missense	probably benign	0.00
IGL03156:Bdp1	APN	13	100061036	missense	probably benign	0.44
IGL03166:Bdp1	APN	13	100035800	missense	probably benign	0.28
IGL03232:Bdp1	APN	13	100051481	missense	probably damaging	1.00
D3080:Bdp1	UTSW	13	100023621	missense	probably benign	0.02
R0115:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0481:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0619:Bdp1	UTSW	13	100037858	missense	probably benign	0.00
R0730:Bdp1	UTSW	13	100058951	splice site	probably benign
R0744:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R0833:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R1307:Bdp1	UTSW	13	100049763	missense	possibly damaging	0.89
R1325:Bdp1	UTSW	13	100099008	missense	probably damaging	0.97
R1346:Bdp1	UTSW	13	100078755	nonsense	probably null
R1644:Bdp1	UTSW	13	100060940	missense	probably benign	0.03
R1670:Bdp1	UTSW	13	100027433	critical splice donor site	probably null
R1836:Bdp1	UTSW	13	100035145	missense	probably benign
R1869:Bdp1	UTSW	13	100042201	missense	probably damaging	0.99
R1920:Bdp1	UTSW	13	100098589	missense	probably benign	0.30
R1944:Bdp1	UTSW	13	100074381	splice site	probably null
R2030:Bdp1	UTSW	13	100061189	missense	probably benign	0.00
R2069:Bdp1	UTSW	13	100050988	missense	probably benign	0.00
R2180:Bdp1	UTSW	13	100061405	small insertion	probably benign
R2263:Bdp1	UTSW	13	100066037	missense	probably damaging	0.96
R2277:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2277:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2278:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2278:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2336:Bdp1	UTSW	13	100053002	missense	probably damaging	0.99
R2380:Bdp1	UTSW	13	100060370	missense	probably benign	0.08
R3154:Bdp1	UTSW	13	100049814	missense	probably damaging	1.00
R4212:Bdp1	UTSW	13	100059585	missense	probably benign
R4322:Bdp1	UTSW	13	100092223	missense	probably damaging	0.97
R4414:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4415:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4764:Bdp1	UTSW	13	100056267	missense	probably damaging	0.99
R4766:Bdp1	UTSW	13	100049868	missense	probably damaging	0.96
R4888:Bdp1	UTSW	13	100051119	missense	probably benign	0.26
R4914:Bdp1	UTSW	13	100056336	missense	probably benign	0.28
R4917:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R4918:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R5170:Bdp1	UTSW	13	100030794	nonsense	probably null
R5266:Bdp1	UTSW	13	100067535	missense	probably benign	0.33
R5312:Bdp1	UTSW	13	100097601	splice site	probably null
R5420:Bdp1	UTSW	13	100066043	missense	possibly damaging	0.88
R5486:Bdp1	UTSW	13	100098510	missense	probably damaging	1.00
R5909:Bdp1	UTSW	13	100092286	missense	probably benign	0.08
R5913:Bdp1	UTSW	13	100051104	missense	probably benign	0.41
R6018:Bdp1	UTSW	13	100038224	missense	probably benign	0.00
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6700:Bdp1	UTSW	13	100025528	missense	probably benign	0.00
R6972:Bdp1	UTSW	13	100037761	missense	probably null	1.00
R6996:Bdp1	UTSW	13	100043813	missense	probably damaging	1.00
R7043:Bdp1	UTSW	13	100078707	missense	probably benign	0.03
R7060:Bdp1	UTSW	13	100059494	missense	probably damaging	1.00
R7105:Bdp1	UTSW	13	100070181	missense	probably damaging	1.00
R7155:Bdp1	UTSW	13	100061151	missense	possibly damaging	0.93
R7175:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7177:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7327:Bdp1	UTSW	13	100041532	missense	probably damaging	0.97
R7512:Bdp1	UTSW	13	100050949	missense	probably benign	0.03
R7562:Bdp1	UTSW	13	100025541	missense	probably benign	0.04
R7583:Bdp1	UTSW	13	100049812	missense	probably damaging	1.00
R7788:Bdp1	UTSW	13	100055251	missense	possibly damaging	0.64
R7842:Bdp1	UTSW	13	100099129	missense	probably damaging	1.00
R7850:Bdp1	UTSW	13	100092324	missense	probably damaging	1.00
R7904:Bdp1	UTSW	13	100041436	missense	probably benign	0.37
R7975:Bdp1	UTSW	13	100020376	missense	probably benign	0.01
R7999:Bdp1	UTSW	13	100058896	missense	possibly damaging	0.93
R8126:Bdp1	UTSW	13	100056282	missense	probably damaging	1.00
R8340:Bdp1	UTSW	13	100065968	missense	possibly damaging	0.61
R8414:Bdp1	UTSW	13	100064477	missense	probably benign	0.03
R8468:Bdp1	UTSW	13	100060568	missense	probably benign	0.04
RF003:Bdp1	UTSW	13	100060449	missense	probably benign	0.31
RF003:Bdp1	UTSW	13	100060450	missense	probably benign	0.31
Z1177:Bdp1	UTSW	13	100061396	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGCAAGTCCTACTGCATAGAC -3'
(R):5'- CTTAAATGACTGGGATTATTGTGTCTT -3'

Sequencing Primer
(F):5'- GTCCTACTGCATAGACACTTACGG -3'
(R):5'- CTCGGGTCAATGAAAGACTCTGTC -3'

Posted On

2018-11-28