Incidental Mutation 'R6969:Slc39a14'
ID543410
Institutional Source Beutler Lab
Gene Symbol Slc39a14
Ensembl Gene ENSMUSG00000022094
Gene Namesolute carrier family 39 (zinc transporter), member 14
SynonymsZip14, G630015O18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R6969 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location70303469-70351425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 70308826 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 383 (V383F)
Ref Sequence ENSEMBL: ENSMUSP00000119040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022688] [ENSMUST00000068044] [ENSMUST00000152067]
Predicted Effect probably damaging
Transcript: ENSMUST00000022688
AA Change: V383F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022688
Gene: ENSMUSG00000022094
AA Change: V383F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Zip 149 480 4.4e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000068044
AA Change: V383F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066108
Gene: ENSMUSG00000022094
AA Change: V383F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Zip 149 480 5.4e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152067
AA Change: V383F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119040
Gene: ENSMUSG00000022094
AA Change: V383F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Zip 149 480 3.3e-69 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A14 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a null allele show dwarfism, scoliosis, osteopenia, short long bones, altered gluconeogenesis and chondrocyte differentiation, low plasma IGF-I and liver zinc levels. Homozygotes for another null allele show reduced liver zinc levels and hepatocyte proliferation after hepatectomy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,981,335 L800H unknown Het
Ap2b1 T A 11: 83,389,726 D788E probably damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgap9 G A 10: 127,326,643 E348K probably benign Het
B4galnt2 A T 11: 95,891,930 F19I probably benign Het
Bdp1 A T 13: 100,074,531 I551N probably damaging Het
Ceacam16 A G 7: 19,852,305 *427Q probably null Het
Chd9 A C 8: 90,978,914 Q260P probably benign Het
Col16a1 A T 4: 130,093,087 probably benign Het
Csmd1 A T 8: 17,216,789 N40K possibly damaging Het
Depdc5 T G 5: 32,983,860 V1368G probably damaging Het
Dnah7b C A 1: 46,358,238 P3943Q probably damaging Het
Dnttip2 A G 3: 122,282,492 Q691R probably damaging Het
Dusp10 T C 1: 184,068,888 L284P probably damaging Het
Efr3b A G 12: 3,968,624 V574A probably benign Het
Erc2 A T 14: 27,898,596 I60F probably damaging Het
Exoc2 A G 13: 30,911,178 V245A probably benign Het
Fasl G T 1: 161,781,675 F37L probably damaging Het
Fat3 G A 9: 16,029,916 P1360S probably benign Het
Gm12666 A G 4: 92,191,589 I54T probably damaging Het
Gpsm1 C T 2: 26,340,543 P502S probably benign Het
Gtpbp10 C A 5: 5,555,331 G124V probably damaging Het
Insm2 T C 12: 55,600,178 C236R probably damaging Het
Irf2bpl A G 12: 86,882,694 Y402H possibly damaging Het
Irx6 A G 8: 92,677,330 E175G probably damaging Het
Kcnh8 C T 17: 52,877,943 R418* probably null Het
Kif3c G A 12: 3,366,114 R45Q probably benign Het
Lpin1 A G 12: 16,580,861 F12S probably damaging Het
Lrba A T 3: 86,619,590 T156S probably benign Het
Lrrc19 G T 4: 94,639,373 N200K probably benign Het
Lrrc7 G A 3: 158,156,913 H1296Y probably benign Het
Ltn1 A T 16: 87,415,690 F661Y probably damaging Het
Macf1 T C 4: 123,457,800 Y1893C probably benign Het
Mmd G C 11: 90,257,536 A15P probably damaging Het
Myh2 T C 11: 67,197,266 F1903L probably benign Het
Myom3 T C 4: 135,801,060 L1072P probably damaging Het
Olfr1350 G A 7: 6,570,321 C110Y probably damaging Het
Olfr1402 A T 3: 97,410,802 Y126* probably null Het
Olfr680-ps1 T C 7: 105,091,256 I128V probably benign Het
Olfr855 A T 9: 19,584,590 T18S possibly damaging Het
Patl2 A T 2: 122,128,929 V18D possibly damaging Het
Pkn1 T C 8: 83,683,426 S395G probably damaging Het
Ptprm A G 17: 66,912,418 I726T possibly damaging Het
Rab3gap2 T C 1: 185,236,012 L187P probably damaging Het
Ric1 A T 19: 29,585,782 E535V probably damaging Het
Ripor3 T C 2: 167,985,737 K598R probably benign Het
Rnf40 A G 7: 127,596,323 E607G possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sbsn A G 7: 30,753,191 T544A probably benign Het
Scaf1 C A 7: 45,007,829 probably benign Het
Sec24a T C 11: 51,700,816 M1018V probably benign Het
Shmt1 C T 11: 60,804,327 A54T probably damaging Het
Slc5a2 A G 7: 128,272,077 T346A probably benign Het
Slco4a1 G A 2: 180,464,808 S261N probably benign Het
Smarcc1 C G 9: 110,196,320 S688R probably damaging Het
Sppl2b G A 10: 80,865,125 A314T probably damaging Het
Sptb A T 12: 76,608,007 V1513E probably damaging Het
Stx17 A T 4: 48,140,462 I56F probably damaging Het
Tbc1d9 A G 8: 83,241,542 Y424C probably damaging Het
Tgm3 A G 2: 130,042,029 K536E probably benign Het
Tti2 A G 8: 31,154,301 I309V possibly damaging Het
Tymp G A 15: 89,374,048 S334L probably benign Het
Unc13b T C 4: 43,263,538 F1587L possibly damaging Het
Vgf G T 5: 137,031,653 probably benign Het
Zfp59 T C 7: 27,853,497 S125P probably damaging Het
Zfp641 A T 15: 98,290,567 M144K possibly damaging Het
Zfp93 A T 7: 24,275,381 K264* probably null Het
Other mutations in Slc39a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Slc39a14 APN 14 70306685 missense possibly damaging 0.91
IGL02348:Slc39a14 APN 14 70316436 critical splice donor site probably null
IGL03108:Slc39a14 APN 14 70318919 missense probably damaging 0.98
IGL03391:Slc39a14 APN 14 70309842 missense probably damaging 1.00
R1741:Slc39a14 UTSW 14 70318744 missense probably damaging 1.00
R2437:Slc39a14 UTSW 14 70316436 critical splice donor site probably null
R4726:Slc39a14 UTSW 14 70313599 critical splice donor site probably null
R4808:Slc39a14 UTSW 14 70315801 missense probably damaging 1.00
R4911:Slc39a14 UTSW 14 70309922 missense probably benign 0.00
R4957:Slc39a14 UTSW 14 70315811 missense probably damaging 0.99
R5815:Slc39a14 UTSW 14 70306745 missense probably damaging 1.00
R6393:Slc39a14 UTSW 14 70309813 missense probably benign 0.02
R6464:Slc39a14 UTSW 14 70306728 missense probably damaging 0.98
R6466:Slc39a14 UTSW 14 70309886 missense probably damaging 1.00
R6757:Slc39a14 UTSW 14 70310884 missense probably damaging 1.00
R7569:Slc39a14 UTSW 14 70309827 missense possibly damaging 0.66
R7711:Slc39a14 UTSW 14 70313675 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGTGTGGCCTTTAGCTG -3'
(R):5'- AGTCTATGAGGGCTTTGCAGC -3'

Sequencing Primer
(F):5'- AGCACTTACCATATCGGCTAGGG -3'
(R):5'- TGCAGCCTCTGTGCTGC -3'
Posted On2018-11-28