Incidental Mutation 'R6521:Mdfic'
ID543421
Institutional Source Beutler Lab
Gene Symbol Mdfic
Ensembl Gene ENSMUSG00000041390
Gene NameMyoD family inhibitor domain containing
Synonymsclone 1.5, Kdt1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R6521 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location15720661-15802169 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 15729028 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101663] [ENSMUST00000120512] [ENSMUST00000125326] [ENSMUST00000128849] [ENSMUST00000140516] [ENSMUST00000189359] [ENSMUST00000190255]
Predicted Effect probably benign
Transcript: ENSMUST00000101663
SMART Domains Protein: ENSMUSP00000099186
Gene: ENSMUSG00000041390

DomainStartEndE-ValueType
Pfam:MDFI 74 247 7.3e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120512
SMART Domains Protein: ENSMUSP00000113050
Gene: ENSMUSG00000041390

DomainStartEndE-ValueType
Pfam:MDFI 74 247 1.6e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125326
SMART Domains Protein: ENSMUSP00000139704
Gene: ENSMUSG00000041390

DomainStartEndE-ValueType
Pfam:MDFI 74 175 6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128849
Predicted Effect unknown
Transcript: ENSMUST00000140516
AA Change: H36Q
Predicted Effect probably benign
Transcript: ENSMUST00000189359
SMART Domains Protein: ENSMUSP00000140208
Gene: ENSMUSG00000041390

DomainStartEndE-ValueType
Pfam:MDFI 74 247 1.6e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190255
SMART Domains Protein: ENSMUSP00000140641
Gene: ENSMUSG00000041390

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:MDFI 156 329 8.8e-73 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: This gene product is a member of a family of proteins characterized by a specific cysteine-rich C-terminal domain, which is involved in transcriptional regulation of viral genome expression. Alternative translation initiation from an upstream non-AUG (GUG), and an in-frame, downstream AUG codon, results in the production of two isoforms, which in human have been shown to have different subcellular localization. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,043,336 S356T probably benign Het
Acsbg2 T C 17: 56,861,565 M185V probably benign Het
Adgrv1 A T 13: 81,433,652 F4758I probably damaging Het
Ank3 A G 10: 69,992,766 probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ano4 A G 10: 88,983,778 V537A probably damaging Het
Catsper2 A G 2: 121,406,807 L204P probably damaging Het
Cdh20 A C 1: 104,942,134 D193A probably damaging Het
Ceacam5 T C 7: 17,750,831 probably null Het
Celf4 T A 18: 25,479,474 probably null Het
Crebbp A T 16: 4,119,128 F754I probably damaging Het
Cyfip2 A T 11: 46,254,588 I635N probably damaging Het
Erbb4 T A 1: 68,042,530 D1131V probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Hoxc8 G A 15: 102,992,703 V193M probably benign Het
Klhdc3 A G 17: 46,677,761 V124A probably benign Het
Klhl18 A G 9: 110,428,635 I509T possibly damaging Het
Maats1 A G 16: 38,306,759 V545A probably benign Het
Mkln1 T A 6: 31,490,544 D64E probably damaging Het
Mmd2 A G 5: 142,574,830 I112T probably damaging Het
Mpl C T 4: 118,455,117 probably null Het
Mtmr4 A G 11: 87,613,527 T1044A possibly damaging Het
Muc5b C A 7: 141,859,171 Y1951* probably null Het
Myo15 C T 11: 60,502,369 H2240Y probably damaging Het
Nckap5 A T 1: 126,382,172 I74K probably damaging Het
Nfxl1 A T 5: 72,540,308 probably null Het
Olfr1018 A T 2: 85,823,450 I160F probably benign Het
Olfr1205 A G 2: 88,831,356 I80V probably benign Het
Olfr736 T C 14: 50,393,548 V264A possibly damaging Het
Olfr924 C T 9: 38,848,597 T161I probably benign Het
Piezo2 T C 18: 63,021,328 Y2460C probably damaging Het
Pigx A G 16: 32,087,311 L64P probably damaging Het
Prss1 C T 6: 41,463,681 T230I probably damaging Het
Ptma A G 1: 86,527,847 probably null Het
Rab39 T C 9: 53,706,031 T29A probably benign Het
Rem2 C T 14: 54,477,687 A107V possibly damaging Het
Senp1 A G 15: 98,048,271 V531A probably damaging Het
Serhl A G 15: 83,101,642 probably null Het
Sirpa T G 2: 129,630,155 Y164D probably damaging Het
Slc12a3 T C 8: 94,343,113 I550T possibly damaging Het
Slc22a14 T C 9: 119,220,769 probably null Het
Slfn5 A G 11: 82,960,415 N513D probably damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Swap70 T C 7: 110,255,820 L109P probably benign Het
Tas2r119 G A 15: 32,178,173 C295Y probably damaging Het
Tcaf3 T A 6: 42,593,238 I527L probably damaging Het
Traj31 A G 14: 54,187,930 probably benign Het
Unc5a T A 13: 55,004,935 D887E probably benign Het
Zfp407 T A 18: 84,432,411 H1600L probably damaging Het
Other mutations in Mdfic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Mdfic APN 6 15741074 missense possibly damaging 0.95
IGL02184:Mdfic APN 6 15770367 missense possibly damaging 0.76
IGL03104:Mdfic APN 6 15770320 missense probably damaging 1.00
IGL03177:Mdfic APN 6 15770451 missense probably damaging 1.00
R0521:Mdfic UTSW 6 15799756 missense probably benign 0.07
R1549:Mdfic UTSW 6 15799845 missense probably damaging 1.00
R1613:Mdfic UTSW 6 15799590 intron probably null
R2496:Mdfic UTSW 6 15741042 missense possibly damaging 0.92
R3087:Mdfic UTSW 6 15799669 missense probably damaging 1.00
R3623:Mdfic UTSW 6 15770320 missense probably damaging 1.00
R3887:Mdfic UTSW 6 15799711 missense probably damaging 1.00
R4736:Mdfic UTSW 6 15741020 missense possibly damaging 0.79
R5704:Mdfic UTSW 6 15770292 missense probably damaging 1.00
R6187:Mdfic UTSW 6 15721197 utr 5 prime probably benign
R6501:Mdfic UTSW 6 15770517 missense possibly damaging 0.48
R6517:Mdfic UTSW 6 15770325 missense probably damaging 1.00
R7761:Mdfic UTSW 6 15728056 missense unknown
R8196:Mdfic UTSW 6 15740990 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- GGAGGAGTAAAGCTGTTCAACC -3'
(R):5'- CCAATGTGCATTTGGCTATATGC -3'

Sequencing Primer
(F):5'- GCTGTTCAACCCTAAGATTCTGAGG -3'
(R):5'- GCATTCCTAATCTTCAAGGGACG -3'
Posted On2018-12-03