Incidental Mutation 'R6521:Celf4'
ID543422
Institutional Source Beutler Lab
Gene Symbol Celf4
Ensembl Gene ENSMUSG00000024268
Gene NameCUGBP, Elav-like family member 4
SynonymsBrunol4, Brul4, BRUNOL-4, A230070D14Rik, C130060B05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6521 (G1)
Quality Score98.0078
Status Validated
Chromosome18
Chromosomal Location25477632-25754157 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 25479474 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153258 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000224553
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, shortened life span dependent on genetic background, and seizures. Mice heterozygous for a null allele exhibit complex seizures and abnormal body weights depending on age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,043,336 S356T probably benign Het
Acsbg2 T C 17: 56,861,565 M185V probably benign Het
Adgrv1 A T 13: 81,433,652 F4758I probably damaging Het
Ank3 A G 10: 69,992,766 probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ano4 A G 10: 88,983,778 V537A probably damaging Het
Catsper2 A G 2: 121,406,807 L204P probably damaging Het
Cdh20 A C 1: 104,942,134 D193A probably damaging Het
Ceacam5 T C 7: 17,750,831 probably null Het
Crebbp A T 16: 4,119,128 F754I probably damaging Het
Cyfip2 A T 11: 46,254,588 I635N probably damaging Het
Erbb4 T A 1: 68,042,530 D1131V probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Hoxc8 G A 15: 102,992,703 V193M probably benign Het
Klhdc3 A G 17: 46,677,761 V124A probably benign Het
Klhl18 A G 9: 110,428,635 I509T possibly damaging Het
Maats1 A G 16: 38,306,759 V545A probably benign Het
Mdfic T A 6: 15,729,028 probably benign Het
Mkln1 T A 6: 31,490,544 D64E probably damaging Het
Mmd2 A G 5: 142,574,830 I112T probably damaging Het
Mpl C T 4: 118,455,117 probably null Het
Mtmr4 A G 11: 87,613,527 T1044A possibly damaging Het
Muc5b C A 7: 141,859,171 Y1951* probably null Het
Myo15 C T 11: 60,502,369 H2240Y probably damaging Het
Nckap5 A T 1: 126,382,172 I74K probably damaging Het
Nfxl1 A T 5: 72,540,308 probably null Het
Olfr1018 A T 2: 85,823,450 I160F probably benign Het
Olfr1205 A G 2: 88,831,356 I80V probably benign Het
Olfr736 T C 14: 50,393,548 V264A possibly damaging Het
Olfr924 C T 9: 38,848,597 T161I probably benign Het
Piezo2 T C 18: 63,021,328 Y2460C probably damaging Het
Pigx A G 16: 32,087,311 L64P probably damaging Het
Prss1 C T 6: 41,463,681 T230I probably damaging Het
Ptma A G 1: 86,527,847 probably null Het
Rab39 T C 9: 53,706,031 T29A probably benign Het
Rem2 C T 14: 54,477,687 A107V possibly damaging Het
Senp1 A G 15: 98,048,271 V531A probably damaging Het
Serhl A G 15: 83,101,642 probably null Het
Sirpa T G 2: 129,630,155 Y164D probably damaging Het
Slc12a3 T C 8: 94,343,113 I550T possibly damaging Het
Slc22a14 T C 9: 119,220,769 probably null Het
Slfn5 A G 11: 82,960,415 N513D probably damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Swap70 T C 7: 110,255,820 L109P probably benign Het
Tas2r119 G A 15: 32,178,173 C295Y probably damaging Het
Tcaf3 T A 6: 42,593,238 I527L probably damaging Het
Traj31 A G 14: 54,187,930 probably benign Het
Unc5a T A 13: 55,004,935 D887E probably benign Het
Zfp407 T A 18: 84,432,411 H1600L probably damaging Het
Other mutations in Celf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Celf4 APN 18 25486950 missense probably damaging 1.00
IGL01608:Celf4 APN 18 25497503 missense probably damaging 1.00
IGL02353:Celf4 APN 18 25486898 missense probably damaging 1.00
IGL02360:Celf4 APN 18 25486898 missense probably damaging 1.00
IGL02614:Celf4 APN 18 25504150 missense probably damaging 1.00
IGL03183:Celf4 APN 18 25537739 missense probably benign 0.05
IGL03183:Celf4 APN 18 25537740 missense probably benign 0.22
R1141:Celf4 UTSW 18 25504904 missense probably damaging 0.99
R1448:Celf4 UTSW 18 25503083 splice site probably null
R2442:Celf4 UTSW 18 25753459 missense probably damaging 1.00
R3958:Celf4 UTSW 18 25537754 missense probably benign 0.08
R3959:Celf4 UTSW 18 25537754 missense probably benign 0.08
R3960:Celf4 UTSW 18 25537754 missense probably benign 0.08
R4256:Celf4 UTSW 18 25491201 missense probably damaging 0.97
R4650:Celf4 UTSW 18 25496245 missense possibly damaging 0.79
R6945:Celf4 UTSW 18 25496236 missense probably damaging 1.00
R7724:Celf4 UTSW 18 25486793 critical splice donor site probably null
R7834:Celf4 UTSW 18 25753485 missense probably benign 0.04
R7917:Celf4 UTSW 18 25753485 missense probably benign 0.04
R8000:Celf4 UTSW 18 25504517 missense probably benign 0.00
RF048:Celf4 UTSW 18 25501321 missense probably benign 0.02
Z1088:Celf4 UTSW 18 25496249 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGCCCCATTGTACACTTGC -3'
(R):5'- TTTAGGGCAGGATGCTGAACG -3'

Sequencing Primer
(F):5'- GTACACTTGCCCCTGCCTG -3'
(R):5'- TGCTGAACGGGCTACATTAAAAAC -3'
Posted On2018-12-03