Incidental Mutation 'R6511:Gas8'
ID543424
Institutional Source Beutler Lab
Gene Symbol Gas8
Ensembl Gene ENSMUSG00000040220
Gene Namegrowth arrest specific 8
SynonymsGas11
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R6511 (G1)
Quality Score55.0072
Status Validated
Chromosome8
Chromosomal Location123518834-123536650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123524157 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 123 (V123A)
Ref Sequence ENSEMBL: ENSMUSP00000148576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093043] [ENSMUST00000212923]
Predicted Effect probably benign
Transcript: ENSMUST00000093043
AA Change: V123A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090730
Gene: ENSMUSG00000040220
AA Change: V123A

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
coiled coil region 26 105 N/A INTRINSIC
coiled coil region 164 199 N/A INTRINSIC
Pfam:GAS 221 420 1.5e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212923
AA Change: V123A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene includes 11 exons spanning 25 kb and maps to a region of chromosome 16 that is sometimes deleted in breast and prostrate cancer. The second intron contains an apparently intronless gene, C16orf3, that is transcribed in the opposite orientation. This gene is a putative tumor suppressor gene. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit postnatal lethality, severe hydrocephaly, situs inversus with levocardia and abnormal cilia morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,376,594 H718Y probably damaging Het
Abcc8 G A 7: 46,150,861 T499I possibly damaging Het
Azin2 C A 4: 128,934,466 R316L probably damaging Het
Cep85l C T 10: 53,278,092 V702I probably benign Het
Cfap69 A T 5: 5,617,220 C442S probably damaging Het
Commd3 G A 2: 18,674,839 G148R probably benign Het
Cyfip2 T C 11: 46,196,308 T1252A probably benign Het
Cyp4a30b A T 4: 115,456,708 D162V probably damaging Het
Exoc3l G T 8: 105,293,255 T346K probably benign Het
Gm8890 A G 5: 11,257,308 Y51C probably benign Het
Hmcn2 T G 2: 31,356,342 D774E possibly damaging Het
Itga1 G T 13: 114,992,501 S540R probably damaging Het
Itpr2 T C 6: 146,329,727 N1145S probably damaging Het
Kcnc2 C T 10: 112,462,067 probably benign Het
Lrp5 G A 19: 3,652,296 R174W probably damaging Het
Lrrn4 T G 2: 132,870,326 S526R probably benign Het
Map3k6 G A 4: 133,248,078 R708H probably damaging Het
Mefv T C 16: 3,715,946 T154A probably benign Het
Mkl2 T A 16: 13,379,850 S66R probably damaging Het
Mtif2 G T 11: 29,536,949 A320S possibly damaging Het
Nos2 A G 11: 78,955,464 probably null Het
Olfr1006 A G 2: 85,674,840 S104P possibly damaging Het
Olfr725 A G 14: 50,034,809 L198P probably damaging Het
Pip5k1c T C 10: 81,310,817 Y44H probably damaging Het
Ppp1r13b T C 12: 111,831,567 E972G probably damaging Het
Prdm12 T C 2: 31,640,309 S71P probably damaging Het
Prkag2 G T 5: 25,100,288 probably benign Het
Ptprb T C 10: 116,346,820 L1467P probably damaging Het
Rnf43 G A 11: 87,732,163 V697I probably benign Het
Rpl7 C A 1: 16,103,665 A12S probably benign Het
Slc25a54 T G 3: 109,094,256 I120S possibly damaging Het
Slc41a2 T C 10: 83,283,788 H370R probably damaging Het
Sv2c C T 13: 96,048,525 V215I probably benign Het
Synpo2l T C 14: 20,662,450 E34G probably damaging Het
Tubgcp5 T A 7: 55,817,392 C703* probably null Het
Vmn1r158 T C 7: 22,790,691 K31R probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp2 A T 11: 50,900,407 C270S probably damaging Het
Other mutations in Gas8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0689:Gas8 UTSW 8 123524106 missense probably damaging 1.00
R1552:Gas8 UTSW 8 123520646 missense probably benign 0.00
R2068:Gas8 UTSW 8 123526537 missense probably damaging 0.96
R4722:Gas8 UTSW 8 123525635 missense possibly damaging 0.88
R4840:Gas8 UTSW 8 123531014 missense probably benign 0.25
R5424:Gas8 UTSW 8 123526512 missense possibly damaging 0.58
R6520:Gas8 UTSW 8 123526474 missense probably benign 0.03
R7318:Gas8 UTSW 8 123530968 missense probably benign
R7398:Gas8 UTSW 8 123518951 start codon destroyed probably null 0.09
R7623:Gas8 UTSW 8 123522979 missense probably damaging 0.96
R7652:Gas8 UTSW 8 123526536 missense probably benign 0.00
R8507:Gas8 UTSW 8 123531038 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCCCATGAGCGTGCAGTAC -3'
(R):5'- GTTAAGGAACCGGTTCAGATGGC -3'

Sequencing Primer
(F):5'- ATGAGCGTGCAGTACCCCTG -3'
(R):5'- TCAGATGGCTGAGTCCCCTC -3'
Posted On2018-12-07