Incidental Mutation 'R6414:Rb1'
ID543427
Institutional Source Beutler Lab
Gene Symbol Rb1
Ensembl Gene ENSMUSG00000022105
Gene NameRB transcriptional corepressor 1
SynonymsRb-1, Rb, pRb
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6414 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location73183673-73325822 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73282974 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 42 (S42G)
Ref Sequence ENSEMBL: ENSMUSP00000125967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022701] [ENSMUST00000164624]
Predicted Effect silent
Transcript: ENSMUST00000022701
SMART Domains Protein: ENSMUSP00000022701
Gene: ENSMUSG00000022105

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 37 53 N/A INTRINSIC
DUF3452 97 223 4.59e-25 SMART
RB_A 367 567 5.53e-92 SMART
CYCLIN 653 740 1.62e-5 SMART
Rb_C 761 920 1.28e-96 SMART
Predicted Effect unknown
Transcript: ENSMUST00000164624
AA Change: S42G
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit abnormalities of the neuronal and hematopoietic systems and die in utero. Heterozygotes may develop pituitary tumors associated with loss of the normal allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A G 11: 69,884,336 V367A probably benign Het
Alpk1 T C 3: 127,680,209 D715G probably benign Het
Atg101 T A 15: 101,290,460 C149S probably benign Het
Atp2c1 A T 9: 105,466,656 I84N probably damaging Het
Ceacam20 C A 7: 19,976,131 A360E probably damaging Het
Chd3 A T 11: 69,352,545 probably null Het
Clcc1 G A 3: 108,676,851 C517Y possibly damaging Het
Col6a5 T C 9: 105,892,266 probably null Het
Ctnna3 T C 10: 64,260,865 V394A probably benign Het
Ctsll3 A G 13: 60,800,299 F188S probably damaging Het
Cyth4 T C 15: 78,608,146 V125A probably damaging Het
Ddx43 G A 9: 78,400,936 V131I probably benign Het
Elp4 A G 2: 105,904,443 S16P possibly damaging Het
Espl1 T A 15: 102,315,560 V1182E probably damaging Het
Fhod3 T C 18: 25,090,878 S1094P possibly damaging Het
Fmo6 A T 1: 162,920,445 V350D probably damaging Het
Frem1 A G 4: 82,940,536 F1545S probably damaging Het
Gata3 T A 2: 9,858,434 H423L possibly damaging Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Golt1a A T 1: 133,320,294 M87L probably damaging Het
Gpr171 A T 3: 59,098,123 V77E probably damaging Het
Hectd2 A G 19: 36,618,786 D757G probably benign Het
Hmmr A G 11: 40,715,867 probably null Het
Il31ra A G 13: 112,523,907 V635A possibly damaging Het
Lama1 T C 17: 67,746,910 probably null Het
Ltbp4 G A 7: 27,310,715 P1140L probably damaging Het
Macf1 A G 4: 123,493,195 L1210P possibly damaging Het
Meox2 A T 12: 37,108,831 M1L probably benign Het
Mex3d A G 10: 80,381,371 S671P unknown Het
Mrgprb2 C T 7: 48,552,381 V199I probably benign Het
Mroh9 A T 1: 163,074,702 V114E probably damaging Het
Muc5b A G 7: 141,859,097 K1927E unknown Het
Olfr1275 A C 2: 111,231,152 probably null Het
Olfr781 T A 10: 129,333,709 I276K probably benign Het
Otogl C T 10: 107,782,050 C1734Y probably damaging Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh15 T A 10: 74,185,426 N162K probably damaging Het
Pcdhb10 A C 18: 37,413,845 H658P possibly damaging Het
Pgm2l1 G T 7: 100,255,540 A160S possibly damaging Het
Prkag2 T A 5: 25,100,180 probably benign Het
Rap1gap2 A G 11: 74,405,790 L457P probably damaging Het
Rasef C T 4: 73,740,581 V463M probably benign Het
Reep3 C A 10: 67,039,577 V36F probably damaging Het
Rhcg A G 7: 79,598,968 probably null Het
Sbno1 T C 5: 124,395,931 S661G probably benign Het
Slc25a3 T G 10: 91,122,328 Q50P possibly damaging Het
Slc2a13 T A 15: 91,343,805 I395F probably benign Het
Slc6a5 C T 7: 49,910,243 probably benign Het
Snta1 G C 2: 154,378,067 T391S possibly damaging Het
Spata7 T C 12: 98,663,220 probably null Het
Stx17 A G 4: 48,158,809 probably null Het
Terf2 A T 8: 107,076,854 S365T probably benign Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trim8 A T 19: 46,502,907 H155L probably benign Het
Wipi2 T A 5: 142,655,938 V83D probably damaging Het
Zfp316 C A 5: 143,254,884 R460L possibly damaging Het
Zfp651 T G 9: 121,763,659 D348E probably benign Het
Zfp799 C T 17: 32,820,285 V336M probably damaging Het
Zfp947 A T 17: 22,146,414 I93N probably damaging Het
Zranb3 A G 1: 128,040,957 Y74H probably benign Het
Other mutations in Rb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Rb1 APN 14 73264598 missense probably damaging 1.00
IGL00951:Rb1 APN 14 73322072 missense probably damaging 1.00
IGL01152:Rb1 APN 14 73205870 missense probably damaging 1.00
IGL01339:Rb1 APN 14 73264371 critical splice acceptor site probably null
IGL01349:Rb1 APN 14 73269118 missense probably damaging 1.00
IGL01390:Rb1 APN 14 73294999 missense probably benign 0.02
IGL02066:Rb1 APN 14 73198534 missense probably benign 0.06
IGL02207:Rb1 APN 14 73206085 missense probably damaging 1.00
IGL02860:Rb1 APN 14 73206012 missense probably damaging 1.00
IGL03370:Rb1 APN 14 73282866 critical splice donor site probably null
rubidium UTSW 14 73199311 missense probably damaging 1.00
P0028:Rb1 UTSW 14 73264628 missense probably damaging 1.00
R0553:Rb1 UTSW 14 73211712 nonsense probably null
R0563:Rb1 UTSW 14 73216767 missense probably damaging 1.00
R0586:Rb1 UTSW 14 73287684 intron probably benign
R0595:Rb1 UTSW 14 73273680 missense probably damaging 1.00
R0755:Rb1 UTSW 14 73197213 makesense probably null
R1480:Rb1 UTSW 14 73262602 missense probably benign
R1513:Rb1 UTSW 14 73322084 missense probably benign 0.00
R1752:Rb1 UTSW 14 73287624 missense probably damaging 0.99
R1919:Rb1 UTSW 14 73212990 nonsense probably null
R2010:Rb1 UTSW 14 73294993 missense probably benign 0.16
R2087:Rb1 UTSW 14 73280252 missense probably benign 0.09
R2152:Rb1 UTSW 14 73288725 missense probably benign
R2167:Rb1 UTSW 14 73211651 missense probably damaging 1.00
R3950:Rb1 UTSW 14 73262662 missense probably damaging 1.00
R4183:Rb1 UTSW 14 73198526 splice site probably null
R4225:Rb1 UTSW 14 73269191 missense possibly damaging 0.58
R4306:Rb1 UTSW 14 73262695 missense probably damaging 1.00
R4464:Rb1 UTSW 14 73199198 splice site probably null
R4609:Rb1 UTSW 14 73262514 splice site probably benign
R4671:Rb1 UTSW 14 73273676 missense probably damaging 1.00
R4916:Rb1 UTSW 14 73216691 missense probably damaging 1.00
R5160:Rb1 UTSW 14 73264455 synonymous silent
R5210:Rb1 UTSW 14 73199311 missense probably damaging 1.00
R5320:Rb1 UTSW 14 73213126 nonsense probably null
R5436:Rb1 UTSW 14 73213140 splice site probably null
R5467:Rb1 UTSW 14 73211620 missense possibly damaging 0.92
R5592:Rb1 UTSW 14 73211747 missense probably damaging 1.00
R6326:Rb1 UTSW 14 73198534 missense probably benign 0.06
R6363:Rb1 UTSW 14 73287641 missense probably benign 0.01
R6395:Rb1 UTSW 14 73199196 missense probably damaging 1.00
R6460:Rb1 UTSW 14 73278454 missense probably benign 0.06
R6503:Rb1 UTSW 14 73205880 missense probably benign 0.08
R6519:Rb1 UTSW 14 73298063 missense probably benign 0.00
R6671:Rb1 UTSW 14 73197266 missense probably damaging 1.00
R7026:Rb1 UTSW 14 73298099 missense probably benign 0.00
R7103:Rb1 UTSW 14 73262644 missense probably damaging 1.00
R7263:Rb1 UTSW 14 73282923 nonsense probably null
R7478:Rb1 UTSW 14 73269137 missense probably damaging 1.00
R7519:Rb1 UTSW 14 73264608 missense probably damaging 1.00
R7817:Rb1 UTSW 14 73198543 missense probably damaging 1.00
R8323:Rb1 UTSW 14 73265583 missense probably benign 0.09
R8809:Rb1 UTSW 14 73265560 missense probably damaging 1.00
R8813:Rb1 UTSW 14 73262587 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCTATAGACAGTCAGTACGGAAC -3'
(R):5'- GAAAAGTCTTTATTGTGGCTGTAGC -3'

Sequencing Primer
(F):5'- TACGGAACTGCTGAAGAAAAGG -3'
(R):5'- AACCCGAGTTTGTCATGGGAC -3'
Posted On2018-12-07