Incidental Mutation 'R6512:Vwa3b'
ID 543430
Institutional Source Beutler Lab
Gene Symbol Vwa3b
Ensembl Gene ENSMUSG00000050122
Gene Name von Willebrand factor A domain containing 3B
Synonyms 4921511C04Rik, A230074B11Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: XM_003084438.1; MGI:1918103

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R6512 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 37026596-37187613 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to G at 37063642 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027289] [ENSMUST00000067178] [ENSMUST00000117172] [ENSMUST00000124404] [ENSMUST00000162449]
AlphaFold A0A571BE33
Predicted Effect probably benign
Transcript: ENSMUST00000027289
SMART Domains Protein: ENSMUSP00000027289
Gene: ENSMUSG00000050122

DomainStartEndE-ValueType
Pfam:DUF4537 159 285 9.1e-36 PFAM
low complexity region 327 336 N/A INTRINSIC
low complexity region 345 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067178
SMART Domains Protein: ENSMUSP00000069700
Gene: ENSMUSG00000050122

DomainStartEndE-ValueType
Blast:VWA 112 272 7e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117172
SMART Domains Protein: ENSMUSP00000114022
Gene: ENSMUSG00000050122

DomainStartEndE-ValueType
Blast:VWA 112 272 7e-16 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000124404
AA Change: T335A
SMART Domains Protein: ENSMUSP00000141690
Gene: ENSMUSG00000050122
AA Change: T335A

DomainStartEndE-ValueType
Blast:VWA 112 272 5e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162449
SMART Domains Protein: ENSMUSP00000125460
Gene: ENSMUSG00000050122

DomainStartEndE-ValueType
Blast:VWA 112 272 7e-16 BLAST
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (39/39)
Allele List at MGI

All alleles(71) : Targeted(3) Gene trapped(68)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,036,863 S211P possibly damaging Het
Abcb11 T C 2: 69,282,652 T674A probably benign Het
Acad11 G T 9: 104,095,559 E484* probably null Het
Ankhd1 A T 18: 36,591,456 D389V probably damaging Het
Asic4 T A 1: 75,473,043 L439* probably null Het
Atp13a2 A G 4: 141,003,218 T808A probably damaging Het
Capn13 C A 17: 73,382,990 V9L probably benign Het
Chst11 A G 10: 83,191,468 Y243C probably damaging Het
Ctdp1 A T 18: 80,451,263 W308R probably damaging Het
Dnttip2 A G 3: 122,275,523 E129G possibly damaging Het
Dock5 A G 14: 67,824,648 S424P possibly damaging Het
Ebf1 C T 11: 44,992,341 H469Y probably damaging Het
Efhc1 A T 1: 20,960,349 N169Y probably damaging Het
Elmo1 T C 13: 20,373,161 L424P probably damaging Het
Ighv1-59 A G 12: 115,335,383 V16A probably damaging Het
Kcnc1 T G 7: 46,427,397 C208G probably damaging Het
Kif13b A T 14: 64,744,874 probably null Het
Lilra6 T A 7: 3,914,388 N203Y probably benign Het
Mkl1 T C 15: 81,013,716 T787A probably benign Het
Myh8 A T 11: 67,289,662 K575* probably null Het
Nedd1 C T 10: 92,691,875 A486T probably benign Het
Olfr170 A T 16: 19,606,359 L103H probably damaging Het
Phrf1 T C 7: 141,260,396 I1168T possibly damaging Het
Pla2g12a T A 3: 129,888,957 H59Q probably benign Het
Ralbp1 A G 17: 65,861,275 V345A probably damaging Het
Ryr3 C T 2: 112,867,378 V894M possibly damaging Het
Sec24b T A 3: 130,041,297 Y84F probably damaging Het
Slc22a26 T C 19: 7,802,500 probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spats1 C T 17: 45,452,673 probably null Het
Tbk1 T A 10: 121,578,621 N63Y probably damaging Het
Tbl1xr1 C T 3: 22,140,534 probably benign Het
Top2b T A 14: 16,409,854 D840E possibly damaging Het
Trpc3 T A 3: 36,662,758 Y377F possibly damaging Het
Uba6 C T 5: 86,124,403 R778K probably benign Het
Vmn2r101 A T 17: 19,588,884 I92F probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r70 G T 7: 85,566,097 F76L probably benign Het
Zfp407 T A 18: 84,560,349 T880S probably damaging Het
Zfp64 C A 2: 168,894,077 G560V probably benign Het
Other mutations in Vwa3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Vwa3b APN 1 37154036 missense probably benign 0.28
IGL02236:Vwa3b APN 1 37154051 splice site probably benign
IGL02653:Vwa3b APN 1 37175565 utr 3 prime probably benign
IGL02823:Vwa3b APN 1 37186904 utr 3 prime probably benign
IGL03030:Vwa3b APN 1 37044968 missense probably damaging 1.00
P0014:Vwa3b UTSW 1 37173914 utr 3 prime probably benign
R0035:Vwa3b UTSW 1 37165689 missense possibly damaging 0.69
R0102:Vwa3b UTSW 1 37135514 missense probably damaging 1.00
R0556:Vwa3b UTSW 1 37164485 splice site probably benign
R1061:Vwa3b UTSW 1 37157430 missense probably damaging 1.00
R1386:Vwa3b UTSW 1 37051881 critical splice donor site probably null
R2441:Vwa3b UTSW 1 37143069 unclassified probably benign
R3117:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R3119:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R4081:Vwa3b UTSW 1 37035824 missense probably damaging 0.99
R4393:Vwa3b UTSW 1 37045178 missense probably damaging 1.00
R4897:Vwa3b UTSW 1 37114603 splice site probably benign
R4950:Vwa3b UTSW 1 37085332 missense probably benign 0.00
R4978:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5141:Vwa3b UTSW 1 37187021 utr 3 prime probably benign
R5286:Vwa3b UTSW 1 37045039 missense probably damaging 1.00
R5356:Vwa3b UTSW 1 37114583 missense probably damaging 0.99
R5426:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5480:Vwa3b UTSW 1 37100706 nonsense probably null
R5727:Vwa3b UTSW 1 37135519 missense probably benign 0.10
R5876:Vwa3b UTSW 1 37076439 missense probably damaging 0.97
R6191:Vwa3b UTSW 1 37114531 missense possibly damaging 0.92
R6219:Vwa3b UTSW 1 37100698 missense possibly damaging 0.92
R6250:Vwa3b UTSW 1 37051885 splice site probably null
R6281:Vwa3b UTSW 1 37123982 missense probably damaging 1.00
R6419:Vwa3b UTSW 1 37157376 missense probably benign 0.01
R6467:Vwa3b UTSW 1 37085286 missense probably benign 0.01
R6541:Vwa3b UTSW 1 37051761 missense probably damaging 1.00
R6724:Vwa3b UTSW 1 37045031 missense probably damaging 1.00
R6728:Vwa3b UTSW 1 37157372 missense probably damaging 1.00
R7046:Vwa3b UTSW 1 37173878 missense probably benign
R7117:Vwa3b UTSW 1 37135553 missense
R7304:Vwa3b UTSW 1 37164505 missense probably damaging 1.00
R7402:Vwa3b UTSW 1 37114597 nonsense probably null
R7762:Vwa3b UTSW 1 37124045 missense probably damaging 1.00
R7911:Vwa3b UTSW 1 37154026 missense probably damaging 1.00
R8213:Vwa3b UTSW 1 37128939 missense probably benign 0.07
R8402:Vwa3b UTSW 1 37165798 missense probably damaging 1.00
R8697:Vwa3b UTSW 1 37076380 missense probably benign 0.09
R8758:Vwa3b UTSW 1 37137792 missense
R8874:Vwa3b UTSW 1 37035758 missense possibly damaging 0.73
R9011:Vwa3b UTSW 1 37115686 missense probably damaging 1.00
R9012:Vwa3b UTSW 1 37085310 missense probably benign 0.15
R9015:Vwa3b UTSW 1 37164516 missense possibly damaging 0.71
R9102:Vwa3b UTSW 1 37135512 start codon destroyed probably null
R9263:Vwa3b UTSW 1 37060412 missense probably benign 0.43
R9277:Vwa3b UTSW 1 37157453 critical splice donor site probably null
R9294:Vwa3b UTSW 1 37035801 missense probably damaging 0.99
R9341:Vwa3b UTSW 1 37114534 missense probably damaging 1.00
R9343:Vwa3b UTSW 1 37114534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCCTTTGCTGAGAGAACAG -3'
(R):5'- CTTGGACCTAACTAACCCCAGG -3'

Sequencing Primer
(F):5'- ACAGAGTGTGAGGAATTCTCTGC -3'
(R):5'- CCCCAGGAATAGCATGGCTAG -3'
Posted On 2018-12-11