Incidental Mutation 'R6477:Myrf'
ID543435
Institutional Source Beutler Lab
Gene Symbol Myrf
Ensembl Gene ENSMUSG00000036098
Gene Namemyelin regulatory factor
SynonymsGm98, LOC386531, LOC225908
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.790) question?
Stock #R6477 (G1)
Quality Score42.0073
Status Validated
Chromosome19
Chromosomal Location10208272-10240748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10228785 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 89 (P89L)
Ref Sequence ENSEMBL: ENSMUSP00000139601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088013] [ENSMUST00000189897]
Predicted Effect probably benign
Transcript: ENSMUST00000088013
AA Change: P89L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085329
Gene: ENSMUSG00000036098
AA Change: P89L

DomainStartEndE-ValueType
low complexity region 67 99 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 285 306 N/A INTRINSIC
low complexity region 320 346 N/A INTRINSIC
Pfam:NDT80_PhoG 393 540 7.6e-31 PFAM
Pfam:Peptidase_S74 587 647 5.3e-16 PFAM
Pfam:MRF_C1 667 702 8.3e-26 PFAM
low complexity region 773 784 N/A INTRINSIC
low complexity region 847 884 N/A INTRINSIC
Pfam:MRF_C2 977 1111 1.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189897
AA Change: P89L

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139601
Gene: ENSMUSG00000036098
AA Change: P89L

DomainStartEndE-ValueType
low complexity region 67 99 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 285 306 N/A INTRINSIC
low complexity region 320 346 N/A INTRINSIC
Pfam:NDT80_PhoG 393 540 7.6e-31 PFAM
Pfam:Peptidase_S74 587 647 1.1e-15 PFAM
Pfam:MRF_C1 667 702 1.1e-26 PFAM
low complexity region 773 784 N/A INTRINSIC
low complexity region 847 884 N/A INTRINSIC
Pfam:MRF_C2 976 1111 5.5e-55 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is required for central nervous system myelination and may regulate oligodendrocyte differentiation. It is thought to act by increasing the expression of genes that effect myelin production but may also directly promote myelin gene expression. Loss of a similar gene in mouse models results in severe demyelination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,257,630 probably null Het
4933415F23Rik A T 1: 23,101,780 L151Q probably benign Het
Aatk T C 11: 120,018,870 D23G probably benign Het
Abca14 T C 7: 120,325,102 I1659T probably benign Het
Ankdd1a C T 9: 65,502,212 V481M probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Cfap161 T A 7: 83,794,022 R20* probably null Het
Cops7a A T 6: 124,960,176 V184E probably damaging Het
Cpa3 T C 3: 20,239,575 E83G possibly damaging Het
Crls1 C T 2: 132,861,233 S201L probably benign Het
Cyp4f39 C A 17: 32,481,817 S153R probably damaging Het
Ddx54 T A 5: 120,621,778 I410N probably damaging Het
Dido1 T A 2: 180,660,481 T1877S probably benign Het
Dip2c A G 13: 9,623,760 S1079G probably damaging Het
Dnhd1 G A 7: 105,677,886 V681I probably benign Het
Dst A G 1: 34,208,728 probably null Het
Eya2 A G 2: 165,763,761 T362A probably benign Het
Hgs G A 11: 120,469,655 V60M probably damaging Het
Inpp4b A G 8: 81,844,714 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kdr C A 5: 75,968,841 A129S probably benign Het
Lhcgr A T 17: 88,742,373 M575K probably damaging Het
Lsamp G T 16: 42,168,165 probably benign Het
Mcm5 T C 8: 75,112,602 V161A probably benign Het
Mmp14 A T 14: 54,437,658 H249L probably damaging Het
Mroh5 A G 15: 73,790,755 S405P probably damaging Het
Mroh9 C A 1: 163,076,304 L46F probably damaging Het
Mtrr A T 13: 68,570,073 H357Q probably damaging Het
Mzb1 C T 18: 35,648,258 probably null Het
Naip6 A G 13: 100,316,008 S182P probably damaging Het
Nmur2 A T 11: 56,029,591 F276Y probably damaging Het
Nudt12 G T 17: 59,011,145 S35Y probably benign Het
Olfr1154 A G 2: 87,902,990 S229P probably damaging Het
Olfr572 T A 7: 102,928,378 V250E probably damaging Het
Olfr657 T C 7: 104,635,679 S2P probably benign Het
Osbpl1a T C 18: 12,756,261 I541V probably benign Het
Parp4 A G 14: 56,647,237 K1258E probably benign Het
Plcxd2 C G 16: 45,980,659 K67N probably damaging Het
Pnpla6 A G 8: 3,536,627 T930A probably benign Het
Pomt1 G A 2: 32,248,716 probably null Het
Pramel6 A G 2: 87,510,602 Y426C possibly damaging Het
Prss27 A G 17: 24,044,261 T83A probably damaging Het
Rbm27 T A 18: 42,333,318 V915E probably damaging Het
Rnf114 T A 2: 167,503,488 D10E probably benign Het
Sbk1 A G 7: 126,291,178 E121G probably damaging Het
Senp6 A T 9: 80,093,625 R39* probably null Het
Sergef A T 7: 46,633,826 I94N probably benign Het
Slc30a9 C T 5: 67,328,524 R183W probably benign Het
Smurf1 C T 5: 144,889,792 R414H possibly damaging Het
Sptb A T 12: 76,606,392 W1566R probably damaging Het
Tenm2 T C 11: 36,010,507 probably null Het
Tnni1 T C 1: 135,805,566 V42A probably benign Het
Tnxb A G 17: 34,719,539 Y3098C probably damaging Het
Ubald2 T C 11: 116,434,574 F46L probably benign Het
Ubqln5 G A 7: 104,128,258 S453F probably damaging Het
Ubr3 A T 2: 69,979,429 R1248* probably null Het
Utp20 A G 10: 88,768,918 V1705A probably benign Het
Zfp60 G A 7: 27,749,803 R632H probably benign Het
Zfp638 A G 6: 83,965,578 Y957C probably damaging Het
Zfp825 A T 13: 74,480,910 S162R possibly damaging Het
Zfp831 A C 2: 174,704,167 K1355T probably benign Het
Other mutations in Myrf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Myrf APN 19 10224513 missense probably benign 0.30
IGL01132:Myrf APN 19 10223205 missense probably damaging 1.00
IGL01958:Myrf APN 19 10210378 unclassified probably benign
IGL02154:Myrf APN 19 10216118 missense probably damaging 0.98
IGL02370:Myrf APN 19 10214140 missense probably benign
IGL02584:Myrf APN 19 10212223 splice site probably benign
IGL02817:Myrf APN 19 10225452 missense probably benign 0.45
R0312:Myrf UTSW 19 10218162 missense probably benign 0.00
R0367:Myrf UTSW 19 10218162 missense probably benign 0.00
R0389:Myrf UTSW 19 10218162 missense probably benign 0.00
R0416:Myrf UTSW 19 10215812 critical splice acceptor site probably null
R0446:Myrf UTSW 19 10218162 missense probably benign 0.00
R0464:Myrf UTSW 19 10218162 missense probably benign 0.00
R0465:Myrf UTSW 19 10218162 missense probably benign 0.00
R0487:Myrf UTSW 19 10218162 missense probably benign 0.00
R0533:Myrf UTSW 19 10218162 missense probably benign 0.00
R0534:Myrf UTSW 19 10218162 missense probably benign 0.00
R0570:Myrf UTSW 19 10211797 missense probably damaging 1.00
R0622:Myrf UTSW 19 10223452 missense probably damaging 0.99
R0631:Myrf UTSW 19 10228882 missense probably benign 0.00
R0721:Myrf UTSW 19 10216080 missense probably damaging 1.00
R0848:Myrf UTSW 19 10218162 missense probably benign 0.00
R1056:Myrf UTSW 19 10223486 missense probably benign 0.11
R1574:Myrf UTSW 19 10225487 missense probably damaging 1.00
R1574:Myrf UTSW 19 10225487 missense probably damaging 1.00
R1801:Myrf UTSW 19 10214191 missense probably benign 0.03
R1897:Myrf UTSW 19 10218232 missense probably benign 0.05
R1950:Myrf UTSW 19 10218190 missense possibly damaging 0.93
R1957:Myrf UTSW 19 10219796 missense probably benign 0.04
R2089:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2091:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2091:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2139:Myrf UTSW 19 10216467 missense probably damaging 0.98
R2144:Myrf UTSW 19 10228674 missense probably benign 0.05
R3932:Myrf UTSW 19 10218151 missense probably damaging 1.00
R3964:Myrf UTSW 19 10219615 missense probably benign 0.03
R3966:Myrf UTSW 19 10219615 missense probably benign 0.03
R3970:Myrf UTSW 19 10223237 missense probably damaging 1.00
R4607:Myrf UTSW 19 10229067 missense probably damaging 1.00
R4746:Myrf UTSW 19 10218591 missense probably damaging 0.99
R5117:Myrf UTSW 19 10212493 missense probably damaging 1.00
R5598:Myrf UTSW 19 10215290 missense probably benign 0.00
R5719:Myrf UTSW 19 10216723 missense probably damaging 1.00
R5841:Myrf UTSW 19 10223547 missense probably null 1.00
R5994:Myrf UTSW 19 10219117 missense probably null 1.00
R6148:Myrf UTSW 19 10212475 missense probably damaging 0.99
R6229:Myrf UTSW 19 10219798 missense probably benign 0.19
R6623:Myrf UTSW 19 10223359 missense probably benign 0.13
R6878:Myrf UTSW 19 10216478 missense possibly damaging 0.80
R6932:Myrf UTSW 19 10219560 missense probably damaging 1.00
R7127:Myrf UTSW 19 10215341 missense probably benign 0.01
R7162:Myrf UTSW 19 10218646 missense possibly damaging 0.75
R7553:Myrf UTSW 19 10228876 missense probably benign
R7585:Myrf UTSW 19 10216727 missense probably damaging 1.00
R7838:Myrf UTSW 19 10219619 missense possibly damaging 0.55
R7921:Myrf UTSW 19 10219619 missense possibly damaging 0.55
X0028:Myrf UTSW 19 10212158 missense probably damaging 1.00
Z1088:Myrf UTSW 19 10221298 missense probably damaging 1.00
Z1177:Myrf UTSW 19 10219544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACTGTGCCCCTAAATCCTG -3'
(R):5'- ACCTCATCCGAGATCTCTGG -3'

Sequencing Primer
(F):5'- GTGCCCCTAAATCCTGTCCCC -3'
(R):5'- ATCCGAGATCTCTGGGCAGTTC -3'
Posted On2018-12-12