Incidental Mutation 'R6499:Ifi214'
ID543439
Institutional Source Beutler Lab
Gene Symbol Ifi214
Ensembl Gene ENSMUSG00000070501
Gene Nameinterferon activated gene 214
SynonymsPyhin-B, BC094916
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173519717-173535957 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 173525031 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 277 (K277N)
Ref Sequence ENSEMBL: ENSMUSP00000087888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090406]
Predicted Effect probably damaging
Transcript: ENSMUST00000090406
AA Change: K277N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087888
Gene: ENSMUSG00000070501
AA Change: K277N

DomainStartEndE-ValueType
PYRIN 6 83 5.01e-17 SMART
low complexity region 152 169 N/A INTRINSIC
Pfam:HIN 231 393 9.1e-71 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the PAAD/DAPIN/Pyrin domain family of proteins. However, compared to the related pyrin and HIN domain family, member 1 (Pyhin1) protein, this protein is C-terminally truncated and lacks a HIN domain, which has an unknown function. It is therefore possible that this gene represents a pseudogene of the Pyhin1 gene, but it is currently being retained as a functional protein-coding gene based on the presence of an intact PAAD/DAPIN/Pyrin domain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Ifi214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Ifi214 APN 1 173529429 missense probably damaging 0.99
IGL01418:Ifi214 APN 1 173529429 missense probably damaging 0.99
IGL01821:Ifi214 APN 1 173529325 missense probably damaging 0.97
IGL03341:Ifi214 APN 1 173526516 missense possibly damaging 0.86
PIT4305001:Ifi214 UTSW 1 173527919 missense probably benign 0.00
R1908:Ifi214 UTSW 1 173529511 missense probably benign 0.44
R4239:Ifi214 UTSW 1 173524943 missense possibly damaging 0.92
R4731:Ifi214 UTSW 1 173526591 missense probably benign 0.26
R4732:Ifi214 UTSW 1 173526591 missense probably benign 0.26
R4733:Ifi214 UTSW 1 173526591 missense probably benign 0.26
R5171:Ifi214 UTSW 1 173526634 missense possibly damaging 0.93
R5531:Ifi214 UTSW 1 173525120 missense probably damaging 1.00
R6290:Ifi214 UTSW 1 173529417 missense probably damaging 1.00
R7271:Ifi214 UTSW 1 173529476 missense probably damaging 0.96
R7290:Ifi214 UTSW 1 173529531 missense probably benign 0.03
R7765:Ifi214 UTSW 1 173524836 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTGATAGCATCTGCCAAAC -3'
(R):5'- ATGTACCCAAAGAACCTTCTGAG -3'

Sequencing Primer
(F):5'- AGCATCTGCCAAACTAAGATTG -3'
(R):5'- CCTTCTGAGGAAAATGGTTACCAGC -3'
Posted On2018-12-13