Incidental Mutation 'R6499:Ifi214'
ID 543439
Institutional Source Beutler Lab
Gene Symbol Ifi214
Ensembl Gene ENSMUSG00000070501
Gene Name interferon activated gene 214
Synonyms BC094916, Pyhin-B
MMRRC Submission 044631-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R6499 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 173348877-173363523 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 173352597 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 277 (K277N)
Ref Sequence ENSEMBL: ENSMUSP00000087888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090406]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000090406
AA Change: K277N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087888
Gene: ENSMUSG00000070501
AA Change: K277N

DomainStartEndE-ValueType
PYRIN 6 83 5.01e-17 SMART
low complexity region 152 169 N/A INTRINSIC
Pfam:HIN 231 393 9.1e-71 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the PAAD/DAPIN/Pyrin domain family of proteins. However, compared to the related pyrin and HIN domain family, member 1 (Pyhin1) protein, this protein is C-terminally truncated and lacks a HIN domain, which has an unknown function. It is therefore possible that this gene represents a pseudogene of the Pyhin1 gene, but it is currently being retained as a functional protein-coding gene based on the presence of an intact PAAD/DAPIN/Pyrin domain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,774,561 (GRCm39) T1250M probably damaging Het
Actn1 C T 12: 80,215,191 (GRCm39) A857T possibly damaging Het
Adam2 C T 14: 66,296,239 (GRCm39) V207I probably damaging Het
Angpt2 T C 8: 18,744,533 (GRCm39) T404A probably benign Het
Ank3 T C 10: 69,827,574 (GRCm39) probably benign Het
Atosa C A 9: 74,930,930 (GRCm39) Q958K probably damaging Het
B4galt4 T A 16: 38,578,184 (GRCm39) D210E probably benign Het
Brinp3 A T 1: 146,777,431 (GRCm39) H626L possibly damaging Het
Ccna2 T G 3: 36,625,112 (GRCm39) D68A probably damaging Het
Cd163 G A 6: 124,281,703 (GRCm39) G2D probably benign Het
Chrm5 A T 2: 112,310,825 (GRCm39) V97D probably benign Het
Dctn5 G A 7: 121,734,320 (GRCm39) V55I probably benign Het
Dnm3 A T 1: 162,141,164 (GRCm39) I365N probably damaging Het
Esyt2 A G 12: 116,284,790 (GRCm39) D184G probably damaging Het
Il11ra1 C T 4: 41,765,412 (GRCm39) P169L probably benign Het
Inhbb C T 1: 119,345,069 (GRCm39) E407K probably damaging Het
Lama2 T A 10: 26,907,154 (GRCm39) T2336S probably damaging Het
Ldhb A T 6: 142,439,847 (GRCm39) V231E possibly damaging Het
Lrit2 T C 14: 36,790,767 (GRCm39) F149L probably damaging Het
Malrd1 T A 2: 15,936,500 (GRCm39) S1575T probably benign Het
Naip5 A G 13: 100,358,102 (GRCm39) C1045R probably benign Het
Nefl A G 14: 68,322,034 (GRCm39) E208G probably damaging Het
Oog4 A C 4: 143,164,548 (GRCm39) S328A probably damaging Het
Or1e1 T A 11: 73,245,011 (GRCm39) L144Q probably damaging Het
Or5p79 G T 7: 108,221,713 (GRCm39) M231I probably benign Het
Or6c216 T C 10: 129,678,453 (GRCm39) I153V probably benign Het
Or7e168 A G 9: 19,719,847 (GRCm39) I78V probably benign Het
Pbrm1 A G 14: 30,783,466 (GRCm39) N528D probably damaging Het
Pls1 A G 9: 95,636,798 (GRCm39) I558T probably damaging Het
Polq T C 16: 36,881,189 (GRCm39) S839P probably benign Het
Psmg1 A G 16: 95,789,297 (GRCm39) F87L probably damaging Het
Ptprt A G 2: 161,376,507 (GRCm39) M1298T probably benign Het
Rbm27 T A 18: 42,470,076 (GRCm39) W958R probably damaging Het
Skint5 T G 4: 113,396,552 (GRCm39) D1207A unknown Het
Stx17 T A 4: 48,183,478 (GRCm39) probably null Het
Tas2r114 A T 6: 131,666,099 (GRCm39) *310R probably null Het
Tmem130 T A 5: 144,689,224 (GRCm39) N139I probably damaging Het
Trpc1 T C 9: 95,608,490 (GRCm39) E267G probably damaging Het
Trrap T A 5: 144,793,812 (GRCm39) M3398K probably damaging Het
Vrtn T G 12: 84,697,090 (GRCm39) D613E probably benign Het
Vsx1 G T 2: 150,530,441 (GRCm39) T147K probably benign Het
Wdr55 T C 18: 36,895,231 (GRCm39) V103A probably benign Het
Zfp712 A T 13: 67,200,400 (GRCm39) D28E probably benign Het
Other mutations in Ifi214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Ifi214 APN 1 173,356,995 (GRCm39) missense probably damaging 0.99
IGL01418:Ifi214 APN 1 173,356,995 (GRCm39) missense probably damaging 0.99
IGL01821:Ifi214 APN 1 173,356,891 (GRCm39) missense probably damaging 0.97
IGL03341:Ifi214 APN 1 173,354,082 (GRCm39) missense possibly damaging 0.86
PIT4305001:Ifi214 UTSW 1 173,355,485 (GRCm39) missense probably benign 0.00
R1908:Ifi214 UTSW 1 173,357,077 (GRCm39) missense probably benign 0.44
R4239:Ifi214 UTSW 1 173,352,509 (GRCm39) missense possibly damaging 0.92
R4731:Ifi214 UTSW 1 173,354,157 (GRCm39) missense probably benign 0.26
R4732:Ifi214 UTSW 1 173,354,157 (GRCm39) missense probably benign 0.26
R4733:Ifi214 UTSW 1 173,354,157 (GRCm39) missense probably benign 0.26
R5171:Ifi214 UTSW 1 173,354,200 (GRCm39) missense possibly damaging 0.93
R5531:Ifi214 UTSW 1 173,352,686 (GRCm39) missense probably damaging 1.00
R6290:Ifi214 UTSW 1 173,356,983 (GRCm39) missense probably damaging 1.00
R7271:Ifi214 UTSW 1 173,357,042 (GRCm39) missense probably damaging 0.96
R7290:Ifi214 UTSW 1 173,357,097 (GRCm39) missense probably benign 0.03
R7765:Ifi214 UTSW 1 173,352,402 (GRCm39) missense probably damaging 0.96
R8712:Ifi214 UTSW 1 173,355,486 (GRCm39) missense possibly damaging 0.83
R8807:Ifi214 UTSW 1 173,354,133 (GRCm39) missense possibly damaging 0.86
R9144:Ifi214 UTSW 1 173,355,434 (GRCm39) missense possibly damaging 0.92
R9452:Ifi214 UTSW 1 173,356,894 (GRCm39) missense possibly damaging 0.79
R9534:Ifi214 UTSW 1 173,354,092 (GRCm39) missense probably benign 0.18
R9721:Ifi214 UTSW 1 173,355,479 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCTGATAGCATCTGCCAAAC -3'
(R):5'- ATGTACCCAAAGAACCTTCTGAG -3'

Sequencing Primer
(F):5'- AGCATCTGCCAAACTAAGATTG -3'
(R):5'- CCTTCTGAGGAAAATGGTTACCAGC -3'
Posted On 2018-12-13