Incidental Mutation 'R6415:Tmem231'
ID543443
Institutional Source Beutler Lab
Gene Symbol Tmem231
Ensembl Gene ENSMUSG00000031951
Gene Nametransmembrane protein 231
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6415 (G1)
Quality Score220.009
Status Validated
Chromosome8
Chromosomal Location111912011-111933881 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 111926892 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034429] [ENSMUST00000211866]
Predicted Effect probably benign
Transcript: ENSMUST00000034429
SMART Domains Protein: ENSMUSP00000034429
Gene: ENSMUSG00000031951

DomainStartEndE-ValueType
Pfam:TM231 1 301 5.8e-131 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000211866
AA Change: H115Y
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein, which is a component of the B9 complex involved in the formation of the diffusion barrier between the cilia and plasma membrane. Mutations in this gene cause Joubert syndrome (JBTS). Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete lethality throughout fetal growth and development, defective patterning of the ventral spinal cord, a striking loss in cilia, severe vascular defects, polydactyly, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,699,972 F328L probably benign Het
4930563M21Rik G A 9: 55,974,012 T482M probably benign Het
9030624J02Rik T C 7: 118,792,646 W494R probably damaging Het
Adam9 A G 8: 24,978,482 Y513H probably damaging Het
Adamts20 C T 15: 94,324,659 probably null Het
B3gnt5 A G 16: 19,770,009 D326G probably damaging Het
Cacna1g A G 11: 94,463,417 I224T probably damaging Het
Ccdc18 A G 5: 108,161,746 I402M probably benign Het
Cckar A T 5: 53,703,056 C73S probably damaging Het
Cdk13 C T 13: 17,739,154 R880H probably damaging Het
Col1a1 A G 11: 94,940,160 N218D unknown Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp2c69 A G 19: 39,842,921 F483L probably benign Het
Ddx60 A G 8: 61,983,905 D963G probably benign Het
Dhx8 G T 11: 101,737,687 A142S unknown Het
Dock7 C T 4: 98,992,448 R926Q probably damaging Het
Dscaml1 C T 9: 45,683,677 Q693* probably null Het
Dysf G A 6: 84,140,042 C1234Y probably damaging Het
Ercc1 G A 7: 19,355,177 probably null Het
Fam91a1 T C 15: 58,442,917 L549P probably damaging Het
Fxyd2 T A 9: 45,403,294 Y5N possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gpr182 T A 10: 127,750,506 D192V possibly damaging Het
Gps1 T C 11: 120,787,722 V286A possibly damaging Het
Grk1 A G 8: 13,413,127 Y383C probably damaging Het
Hic1 G A 11: 75,166,317 P582L possibly damaging Het
Hist1h2bn T C 13: 21,754,486 Y122H probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Lactb T C 9: 66,970,645 K301E possibly damaging Het
Lrp3 A T 7: 35,204,168 V251E probably benign Het
Mapt G A 11: 104,298,998 G265S probably benign Het
Obscn A T 11: 59,035,130 D6245E probably damaging Het
Olfr118 G T 17: 37,672,557 C178F possibly damaging Het
Olfr1257 T C 2: 89,880,862 L12P probably damaging Het
Olfr1273-ps T A 2: 90,296,037 I275F probably damaging Het
Olfr340 A G 2: 36,452,605 S7G probably damaging Het
Olfr58 T A 9: 19,783,748 I205N probably damaging Het
Olfr777 T C 10: 129,269,021 T101A probably benign Het
Olfr832 T C 9: 18,945,119 L157P probably damaging Het
Oxsm A T 14: 16,241,904 H288Q probably benign Het
Pcdh9 C T 14: 93,015,842 M1128I possibly damaging Het
Pcdha8 T C 18: 36,994,561 Y699H probably damaging Het
Pgk2 A T 17: 40,207,568 I323N probably benign Het
Plin4 A G 17: 56,103,264 V1216A probably damaging Het
Ppargc1a T C 5: 51,462,834 probably benign Het
Ppil2 A G 16: 17,103,574 probably null Het
Prelp A T 1: 133,912,778 I322N probably benign Het
Prelp A T 1: 133,914,657 I250N probably damaging Het
Prss27 T A 17: 24,042,908 C63* probably null Het
Rab38 G A 7: 88,430,540 A47T possibly damaging Het
Rprd2 G A 3: 95,774,219 A436V probably benign Het
Sacs A T 14: 61,205,359 N1618I probably damaging Het
Scp2 T G 4: 108,105,140 S63R probably benign Het
Sftpb T G 6: 72,304,649 W9G probably damaging Het
Slco1a4 A T 6: 141,834,689 L125* probably null Het
Sptlc1 T C 13: 53,351,692 probably null Het
Sub1 T A 15: 11,986,474 M96L probably benign Het
Tanc1 T C 2: 59,837,114 V1233A probably benign Het
Tmem140 A T 6: 34,872,723 D58V probably damaging Het
Tpt1 T C 14: 75,846,371 Y91H probably benign Het
Trap1 C T 16: 4,043,992 R636H possibly damaging Het
Ttc14 A G 3: 33,803,575 H275R possibly damaging Het
Zbtb44 T A 9: 31,064,214 I380N possibly damaging Het
Zcchc6 T A 13: 59,816,296 probably null Het
Zswim5 T C 4: 116,980,866 F798L possibly damaging Het
Other mutations in Tmem231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Tmem231 APN 8 111918440 splice site probably benign
IGL02800:Tmem231 APN 8 111914032 missense probably benign 0.03
R2281:Tmem231 UTSW 8 111918931 missense probably damaging 1.00
R2306:Tmem231 UTSW 8 111918871 missense probably damaging 1.00
R3615:Tmem231 UTSW 8 111918313 missense possibly damaging 0.63
R3616:Tmem231 UTSW 8 111918313 missense possibly damaging 0.63
R4541:Tmem231 UTSW 8 111914592 missense probably benign 0.02
R4708:Tmem231 UTSW 8 111933786 start gained probably benign
R5522:Tmem231 UTSW 8 111918410 missense possibly damaging 0.92
R6266:Tmem231 UTSW 8 111915265 missense probably null 0.71
R6414:Tmem231 UTSW 8 111926892 intron probably benign
R6418:Tmem231 UTSW 8 111926892 intron probably benign
R6419:Tmem231 UTSW 8 111926892 intron probably benign
R6622:Tmem231 UTSW 8 111918931 missense probably damaging 1.00
R6938:Tmem231 UTSW 8 111933512 missense probably damaging 0.97
R7103:Tmem231 UTSW 8 111918885 synonymous probably null
R7221:Tmem231 UTSW 8 111933676 missense probably benign
R7305:Tmem231 UTSW 8 111915295 missense possibly damaging 0.70
R7438:Tmem231 UTSW 8 111918408 missense probably damaging 1.00
R7781:Tmem231 UTSW 8 111918290 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTCCCAGACATGGTGAAGCC -3'
(R):5'- CTACAGTATTTGGCCTGTGACAAAC -3'

Sequencing Primer
(F):5'- CCAGGCTGGGTCTATATATTCAGAGC -3'
(R):5'- GTGACAAACAGCAAATATTAGCTAC -3'
Posted On2018-12-19