Incidental Mutation 'R6563:Sh3bgr'
ID543445
Institutional Source Beutler Lab
Gene Symbol Sh3bgr
Ensembl Gene ENSMUSG00000040666
Gene NameSH3-binding domain glutamic acid-rich protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R6563 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location96200470-96228933 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 96205943 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129904] [ENSMUST00000129904] [ENSMUST00000129904]
Predicted Effect probably null
Transcript: ENSMUST00000129904
SMART Domains Protein: ENSMUSP00000116740
Gene: ENSMUSG00000040666

DomainStartEndE-ValueType
Pfam:SH3BGR 30 119 8.2e-43 PFAM
low complexity region 141 159 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129904
SMART Domains Protein: ENSMUSP00000116740
Gene: ENSMUSG00000040666

DomainStartEndE-ValueType
Pfam:SH3BGR 30 119 8.2e-43 PFAM
low complexity region 141 159 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129904
SMART Domains Protein: ENSMUSP00000116740
Gene: ENSMUSG00000040666

DomainStartEndE-ValueType
Pfam:SH3BGR 30 119 8.2e-43 PFAM
low complexity region 141 159 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,258,982 V92A possibly damaging Het
Arhgap11a A T 2: 113,833,902 C679S probably benign Het
Atg4d C T 9: 21,268,460 L235F possibly damaging Het
Cyp2d22 A T 15: 82,371,912 W174R probably damaging Het
Cyp4a14 T A 4: 115,492,086 H259L probably benign Het
Dennd3 A T 15: 73,544,380 H493L probably damaging Het
Diexf C A 1: 193,118,390 R374L probably damaging Het
Dnm1 T A 2: 32,312,726 D759V probably damaging Het
Dvl1 T A 4: 155,856,253 N443K probably damaging Het
Dync2h1 A G 9: 7,120,819 V2156A probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Fam83c A G 2: 155,830,952 V295A probably damaging Het
Gphn T C 12: 78,680,396 probably null Het
Irs1 T A 1: 82,288,407 N696I probably damaging Het
Kmt5c A G 7: 4,742,629 Y96C probably damaging Het
Krt77 G T 15: 101,862,923 T315N probably damaging Het
L3mbtl3 A C 10: 26,302,863 probably null Het
Lama3 A T 18: 12,537,766 Y2409F probably damaging Het
Lrrc9 A G 12: 72,486,395 probably null Het
Ltbp4 A T 7: 27,309,063 N1273K probably damaging Het
Mfsd13b G A 7: 120,995,467 A321T probably damaging Het
Mvb12b A T 2: 33,825,116 H167Q probably benign Het
Myo1g T A 11: 6,517,146 N230Y possibly damaging Het
Olfr57 A T 10: 79,035,217 R140S possibly damaging Het
Prkar2b G T 12: 31,993,786 probably null Het
Pwwp2a G T 11: 43,705,765 A586S possibly damaging Het
Ryr1 A G 7: 29,095,492 V1150A possibly damaging Het
Slk T C 19: 47,636,469 probably null Het
Snx3 A G 10: 42,526,036 E82G possibly damaging Het
Srcin1 A T 11: 97,534,774 Y486N possibly damaging Het
Tecpr2 A G 12: 110,929,087 E336G probably benign Het
Terf2ip G T 8: 112,018,202 V384F probably damaging Het
Tnn T A 1: 160,088,398 S1250C probably damaging Het
Tspoap1 A G 11: 87,777,159 E1263G possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Vmn1r175 A G 7: 23,808,605 I199T possibly damaging Het
Vmn1r225 C T 17: 20,502,501 A68V probably benign Het
Vmn2r24 A T 6: 123,804,178 N448Y possibly damaging Het
Other mutations in Sh3bgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Sh3bgr APN 16 96206490 missense probably damaging 1.00
IGL01404:Sh3bgr APN 16 96206490 missense probably damaging 1.00
R0201:Sh3bgr UTSW 16 96228517 unclassified probably benign
R5042:Sh3bgr UTSW 16 96205866 missense probably benign 0.01
R5203:Sh3bgr UTSW 16 96224520 unclassified probably benign
R5434:Sh3bgr UTSW 16 96224544 unclassified probably benign
R5441:Sh3bgr UTSW 16 96205917 missense possibly damaging 0.68
R6869:Sh3bgr UTSW 16 96206660 missense probably damaging 1.00
R6873:Sh3bgr UTSW 16 96206491 missense probably damaging 1.00
R7260:Sh3bgr UTSW 16 96224481 missense unknown
R7373:Sh3bgr UTSW 16 96205835 missense unknown
R7382:Sh3bgr UTSW 16 96205893 missense probably benign 0.04
R7459:Sh3bgr UTSW 16 96205922 missense probably benign 0.02
R8241:Sh3bgr UTSW 16 96223870 missense unknown
R8268:Sh3bgr UTSW 16 96224474 missense unknown
R8396:Sh3bgr UTSW 16 96206480 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGTCTCCAAACTGTGACCCC -3'
(R):5'- CCTTAGCCAGACTGGAACAAG -3'

Sequencing Primer
(F):5'- AAACTGTGACCCCCTCCGTG -3'
(R):5'- ACCTGGCCTGGGAGATTG -3'
Posted On2018-12-21