Incidental Mutation 'R6551:Usp8'
ID543459
Institutional Source Beutler Lab
Gene Symbol Usp8
Ensembl Gene ENSMUSG00000027363
Gene Nameubiquitin specific peptidase 8
SynonymsUbpy
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6551 (G1)
Quality Score218.009
Status Validated
Chromosome2
Chromosomal Location126707328-126759297 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 126733182 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028841] [ENSMUST00000110416] [ENSMUST00000136319]
Predicted Effect probably benign
Transcript: ENSMUST00000028841
SMART Domains Protein: ENSMUSP00000028841
Gene: ENSMUSG00000027363

DomainStartEndE-ValueType
Pfam:USP8_dimer 6 116 2.3e-37 PFAM
low complexity region 119 140 N/A INTRINSIC
RHOD 185 310 3.69e-7 SMART
low complexity region 378 393 N/A INTRINSIC
coiled coil region 467 501 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
Pfam:UCH 738 1068 4e-88 PFAM
Pfam:UCH_1 739 1053 1.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110416
SMART Domains Protein: ENSMUSP00000106046
Gene: ENSMUSG00000027363

DomainStartEndE-ValueType
Pfam:USP8_dimer 6 127 2.5e-36 PFAM
low complexity region 130 151 N/A INTRINSIC
RHOD 196 321 3.69e-7 SMART
low complexity region 389 404 N/A INTRINSIC
coiled coil region 478 512 N/A INTRINSIC
low complexity region 653 668 N/A INTRINSIC
Pfam:UCH 749 1079 1.3e-82 PFAM
Pfam:UCH_1 750 1064 3.7e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000136319
AA Change: H267L
SMART Domains Protein: ENSMUSP00000121578
Gene: ENSMUSG00000027364
AA Change: H267L

DomainStartEndE-ValueType
Pfam:UCH 1 268 1.9e-39 PFAM
Pfam:UCH_1 1 269 1.3e-14 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the ubiquitin-specific processing protease family of proteins. The encoded protein is thought to regulate the morphology of the endosome by ubiquitination of proteins on this organelle and is involved in cargo sorting and membrane trafficking at the early endosome stage. This protein is required for the cell to enter the S phase of the cell cycle and also functions as a positive regulator in the Hedgehog signaling pathway in development. Pseudogenes of this gene are present on chromosomes 2 and 6. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele appear severely growth retarded and disorganized at E9.5 and die in utero due to ventral-folding defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A T 1: 193,174,523 Q61L probably damaging Het
Acss2 T C 2: 155,551,208 S285P probably benign Het
Ager A G 17: 34,599,468 probably null Het
Alkbh7 T A 17: 56,998,945 Y115* probably null Het
Brwd1 T C 16: 95,993,962 D2184G possibly damaging Het
Chp1 T A 2: 119,571,813 H89Q possibly damaging Het
Clmp T C 9: 40,771,277 V119A probably benign Het
Cryge A T 1: 65,048,637 M171K probably benign Het
Cttnbp2nl A T 3: 105,005,117 S484T possibly damaging Het
Dsg3 C A 18: 20,539,911 P880T unknown Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Espn T C 4: 152,128,766 Het
Fbxo31 A C 8: 121,564,704 probably benign Het
Grin2b A G 6: 135,733,344 V1068A probably damaging Het
Jak1 C A 4: 101,193,843 probably benign Het
Klra10 A T 6: 130,275,755 D185E probably benign Het
Lhx1 A C 11: 84,521,913 D60E probably benign Het
Lyar C A 5: 38,233,272 A326D probably damaging Het
Muc16 A C 9: 18,562,562 S1280A possibly damaging Het
Nol9 G A 4: 152,051,868 V466I possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1120 T C 2: 87,846,661 V130A possibly damaging Het
Olfr1380 G T 11: 49,563,989 V23L probably benign Het
Olfr23 T C 11: 73,940,303 I19T probably benign Het
Olfr317 A T 11: 58,732,757 M136K probably damaging Het
Olfr959 C A 9: 39,572,560 R233L probably benign Het
Pik3c2a A T 7: 116,417,496 I342N probably damaging Het
Pnldc1 A G 17: 12,905,569 M133T probably damaging Het
Rab11fip1 G A 8: 27,156,484 S188L probably damaging Het
Rapgef2 A T 3: 79,215,035 probably null Het
Rnf103 G A 6: 71,510,365 C660Y probably damaging Het
Rph3al G A 11: 75,906,546 S108F possibly damaging Het
Srsf7 A C 17: 80,204,219 probably benign Het
Ssrp1 A G 2: 85,041,106 probably null Het
Tamm41 T C 6: 115,012,181 D284G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem39b A G 4: 129,692,103 V25A probably benign Het
Tmem88b G T 4: 155,785,692 probably benign Het
Unk T C 11: 116,050,724 W266R probably damaging Het
Zbtb48 T G 4: 152,022,221 Q142P probably benign Het
Zdhhc18 T C 4: 133,613,649 T267A probably benign Het
Zfp335 G A 2: 164,909,365 P94S probably benign Het
Other mutations in Usp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Usp8 APN 2 126758560 missense probably damaging 1.00
IGL00771:Usp8 APN 2 126725433 splice site probably null
IGL01073:Usp8 APN 2 126718114 missense probably damaging 0.96
IGL01722:Usp8 APN 2 126758152 missense probably damaging 1.00
IGL02100:Usp8 APN 2 126737854 intron probably benign
IGL02210:Usp8 APN 2 126718056 intron probably benign
IGL02516:Usp8 APN 2 126742174 missense probably benign 0.00
IGL02743:Usp8 APN 2 126734023 missense probably damaging 1.00
IGL02953:Usp8 APN 2 126737937 missense probably benign
satsuke UTSW 2 126751111 missense probably damaging 1.00
R0045:Usp8 UTSW 2 126742223 missense probably benign 0.03
R0048:Usp8 UTSW 2 126737889 missense probably damaging 0.96
R0048:Usp8 UTSW 2 126737889 missense probably damaging 0.96
R0143:Usp8 UTSW 2 126755089 intron probably benign
R0427:Usp8 UTSW 2 126718032 intron probably benign
R0440:Usp8 UTSW 2 126725390 missense probably benign 0.00
R0636:Usp8 UTSW 2 126720110 missense possibly damaging 0.87
R0828:Usp8 UTSW 2 126742114 intron probably benign
R1468:Usp8 UTSW 2 126754927 missense probably damaging 1.00
R1468:Usp8 UTSW 2 126754927 missense probably damaging 1.00
R1782:Usp8 UTSW 2 126720051 missense probably damaging 1.00
R1860:Usp8 UTSW 2 126756040 missense probably damaging 1.00
R2127:Usp8 UTSW 2 126737575 intron probably null
R2259:Usp8 UTSW 2 126758568 missense probably benign 0.32
R2892:Usp8 UTSW 2 126758155 missense probably damaging 1.00
R2893:Usp8 UTSW 2 126758155 missense probably damaging 1.00
R3104:Usp8 UTSW 2 126758512 missense probably damaging 1.00
R4074:Usp8 UTSW 2 126752370 missense probably damaging 1.00
R4678:Usp8 UTSW 2 126725429 missense probably null 1.00
R4715:Usp8 UTSW 2 126729222 missense possibly damaging 0.80
R4832:Usp8 UTSW 2 126755038 missense probably damaging 1.00
R4914:Usp8 UTSW 2 126720140 nonsense probably null
R4915:Usp8 UTSW 2 126720140 nonsense probably null
R4918:Usp8 UTSW 2 126720140 nonsense probably null
R5262:Usp8 UTSW 2 126751111 missense probably damaging 1.00
R5625:Usp8 UTSW 2 126742277 missense probably damaging 1.00
R5667:Usp8 UTSW 2 126742425 missense probably benign 0.00
R5671:Usp8 UTSW 2 126742425 missense probably benign 0.00
R5984:Usp8 UTSW 2 126742481 missense probably benign 0.10
R6529:Usp8 UTSW 2 126725378 missense probably benign 0.01
R6885:Usp8 UTSW 2 126752310 missense probably damaging 1.00
R7768:Usp8 UTSW 2 126751123 missense probably damaging 1.00
R8097:Usp8 UTSW 2 126754880 missense probably benign 0.44
R8130:Usp8 UTSW 2 126717998 intron probably benign
Z1177:Usp8 UTSW 2 126758431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCAAAGTAATTGTGTACTGATC -3'
(R):5'- TCCCAACTGTATCTGGTATTAGTTC -3'

Sequencing Primer
(F):5'- CTCGAAGCTGTTGGTGAT -3'
(R):5'- GGAATGGGGTATGCAATTTG -3'
Posted On2019-01-04