Incidental Mutation 'R6578:Rax'
ID543468
Institutional Source Beutler Lab
Gene Symbol Rax
Ensembl Gene ENSMUSG00000024518
Gene Nameretina and anterior neural fold homeobox
Synonymsey1, Rx, E130303K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.657) question?
Stock #R6578 (G1)
Quality Score59.0073
Status Validated
Chromosome18
Chromosomal Location65934639-65939089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65938667 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 50 (T50A)
Ref Sequence ENSEMBL: ENSMUSP00000025396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025396]
Predicted Effect probably benign
Transcript: ENSMUST00000025396
AA Change: T50A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000025396
Gene: ENSMUSG00000024518
AA Change: T50A

DomainStartEndE-ValueType
low complexity region 128 135 N/A INTRINSIC
HOX 136 198 1.25e-27 SMART
low complexity region 207 253 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
Pfam:OAR 314 334 1.4e-12 PFAM
Meta Mutation Damage Score 0.0679 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox-containing transcription factor that functions in eye development. The gene is expressed early in the eye primordia, and is required for retinal cell fate determination and also regulates stem cell proliferation. Mutations in this gene have been reported in patients with defects in ocular development, including microphthalmia, anophthalmia, and coloboma.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mutants die neonatally with severe brain defects including absence of forebrain/midbrain structures and fail to form eye structures. Homozygous hypomorph mutants are viable, but lack eyes and optic tracts and have hypothalamic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G A 6: 146,953,314 R77* probably null Het
Aldh9a1 A G 1: 167,355,759 Y182C probably damaging Het
Alpk3 T A 7: 81,078,684 S521T probably benign Het
Ankzf1 A G 1: 75,197,757 R464G possibly damaging Het
Baz2b T C 2: 59,969,279 E232G possibly damaging Het
Bbs2 T C 8: 94,077,041 S524G probably null Het
Casp1 A G 9: 5,304,280 K318R probably benign Het
Clock T A 5: 76,216,709 Q853L unknown Het
Clstn3 A G 6: 124,450,704 probably null Het
Ebpl A C 14: 61,360,320 V24G probably benign Het
Erbb2 T C 11: 98,428,188 C568R probably damaging Het
Gcm2 A G 13: 41,105,678 I105T probably damaging Het
Gm7145 C T 1: 117,985,795 P136S probably damaging Het
Helb G T 10: 120,111,181 R76S probably damaging Het
Hipk4 T C 7: 27,528,387 I186T probably damaging Het
Igdcc3 A G 9: 65,182,019 D499G probably damaging Het
Krt26 T A 11: 99,334,802 Q284H probably damaging Het
Lama4 T C 10: 39,017,365 I156T probably benign Het
Mical2 T A 7: 112,311,445 F274Y probably damaging Het
Mug1 A T 6: 121,887,452 Q1436L probably benign Het
Nin A G 12: 70,061,194 V208A probably damaging Het
Olfr1181 T C 2: 88,423,144 S294G probably benign Het
Pappa T A 4: 65,156,137 N309K possibly damaging Het
Pdcd11 T C 19: 47,111,081 V873A probably benign Het
Phf14 G A 6: 11,991,997 C724Y probably damaging Het
Pik3r2 T G 8: 70,772,639 I127L probably benign Het
Polr1a T A 6: 71,976,041 M1531K possibly damaging Het
Pwwp2b T C 7: 139,256,112 C490R probably damaging Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Sema4c C T 1: 36,550,753 V507I probably benign Het
Skint8 C T 4: 111,936,962 T183I probably benign Het
Spata16 C T 3: 26,667,548 Q73* probably null Het
Sync T C 4: 129,294,267 L364P probably damaging Het
Syne1 T A 10: 5,405,454 K376* probably null Het
Tanc1 C T 2: 59,795,954 R552C probably damaging Het
Tdrd6 T C 17: 43,628,961 I399V possibly damaging Het
Vps13b T C 15: 35,446,101 C455R probably damaging Het
Other mutations in Rax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02542:Rax APN 18 65938630 missense possibly damaging 0.68
IGL03290:Rax APN 18 65938160 missense probably damaging 1.00
R4210:Rax UTSW 18 65935081 missense unknown
R4211:Rax UTSW 18 65935081 missense unknown
R5138:Rax UTSW 18 65938318 intron probably benign
R6039:Rax UTSW 18 65935347 missense unknown
R6039:Rax UTSW 18 65935347 missense unknown
R6235:Rax UTSW 18 65935161 missense unknown
R7870:Rax UTSW 18 65938213 missense probably benign 0.09
R7953:Rax UTSW 18 65938213 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TAACCTCAAGTCGGGCAAAC -3'
(R):5'- CGAGCTCCAGTTTGCAAAG -3'

Sequencing Primer
(F):5'- AGAAGCTCCGGTCTTGCAGAG -3'
(R):5'- GCAAAGTGCACTCCCTCCTC -3'
Posted On2019-01-10