Incidental Mutation 'R6539:Trpc4ap'
ID543481
Institutional Source Beutler Lab
Gene Symbol Trpc4ap
Ensembl Gene ENSMUSG00000038324
Gene Nametransient receptor potential cation channel, subfamily C, member 4 associated protein
SynonymsD2Ertd113e, Trrp4ap, 4833429F06Rik, Trp4-associated protein TAP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R6539 (G1)
Quality Score46.0072
Status Validated
Chromosome2
Chromosomal Location155634271-155692384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 155636258 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 663 (P663T)
Ref Sequence ENSEMBL: ENSMUSP00000037574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041059] [ENSMUST00000103140]
Predicted Effect probably benign
Transcript: ENSMUST00000041059
AA Change: P663T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000037574
Gene: ENSMUSG00000038324
AA Change: P663T

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 407 714 5.2e-135 PFAM
low complexity region 724 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103140
AA Change: P655T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099429
Gene: ENSMUSG00000038324
AA Change: P655T

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 399 710 1.1e-138 PFAM
low complexity region 716 727 N/A INTRINSIC
Meta Mutation Damage Score 0.0745 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik A G 10: 77,984,488 T231A probably benign Het
Adam5 G A 8: 24,782,600 A513V possibly damaging Het
Ano8 T C 8: 71,484,483 D147G probably damaging Het
Apba1 A G 19: 23,936,560 D649G probably damaging Het
Atp6v0d1 T C 8: 105,524,974 I329V probably benign Het
Card6 T A 15: 5,105,391 N110I probably damaging Het
Chn2 T A 6: 54,173,461 probably null Het
Cyp46a1 G A 12: 108,353,157 probably null Het
Daam2 T A 17: 49,469,711 H782L probably damaging Het
Defa26 A G 8: 21,618,246 I22V possibly damaging Het
Dlk1 A G 12: 109,460,319 M278V probably benign Het
Dync2h1 T C 9: 7,159,478 probably null Het
Ehmt1 T A 2: 24,804,767 H1056L probably damaging Het
Ephb3 G A 16: 21,221,468 D527N probably benign Het
Fam46a T C 9: 85,326,561 I70V possibly damaging Het
Flt1 T C 5: 147,578,376 K1079E probably benign Het
Fndc3b C T 3: 27,538,057 G231R probably benign Het
Gm4924 T A 10: 82,378,524 probably benign Het
Ifrd1 G A 12: 40,203,435 A426V probably damaging Het
Ift140 T C 17: 25,094,669 L1358P possibly damaging Het
Igkv5-37 A T 6: 69,963,816 S16T probably benign Het
Map3k9 A G 12: 81,732,192 L449P probably damaging Het
Mdm1 T C 10: 118,150,958 probably null Het
Mmrn1 A T 6: 60,987,184 T1056S probably benign Het
Mroh2b C T 15: 4,905,574 H164Y probably damaging Het
Muc16 T C 9: 18,637,325 T5891A probably benign Het
Nagpa T C 16: 5,203,701 E62G possibly damaging Het
Nek10 T A 14: 14,860,789 V475D possibly damaging Het
Olfr1188 T C 2: 88,559,520 F6S probably damaging Het
Olfr194 A C 16: 59,119,751 S106R probably damaging Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Parvg T A 15: 84,341,340 D349E probably damaging Het
Pitpna A G 11: 75,598,301 Y58C probably damaging Het
Ppp4r3b T A 11: 29,218,503 D73E probably benign Het
Preb A G 5: 30,956,076 V338A probably benign Het
Sec23a T C 12: 58,985,212 T411A probably benign Het
Smc6 A G 12: 11,297,010 probably null Het
Stxbp5l A G 16: 37,129,815 M1056T probably damaging Het
Tbcd T A 11: 121,556,987 probably null Het
Tpx2 G T 2: 152,876,598 E174* probably null Het
Unc5cl G A 17: 48,465,017 G441D probably damaging Het
Xrcc2 G T 5: 25,692,532 R140S probably benign Het
Zfc3h1 G A 10: 115,412,002 E1037K probably benign Het
Zfhx4 A T 3: 5,244,108 Q798L probably damaging Het
Zfp94 G A 7: 24,303,291 T236M probably damaging Het
Other mutations in Trpc4ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Trpc4ap APN 2 155639535 missense possibly damaging 0.90
IGL02149:Trpc4ap APN 2 155639547 missense probably damaging 0.97
IGL02313:Trpc4ap APN 2 155650468 missense probably damaging 1.00
IGL02408:Trpc4ap APN 2 155671069 missense possibly damaging 0.71
R0057:Trpc4ap UTSW 2 155640486 missense possibly damaging 0.94
R0057:Trpc4ap UTSW 2 155640486 missense possibly damaging 0.94
R0255:Trpc4ap UTSW 2 155657946 splice site probably benign
R0306:Trpc4ap UTSW 2 155636260 missense probably benign 0.37
R0382:Trpc4ap UTSW 2 155636230 missense probably damaging 1.00
R0525:Trpc4ap UTSW 2 155640478 missense possibly damaging 0.85
R1184:Trpc4ap UTSW 2 155645070 splice site probably benign
R1711:Trpc4ap UTSW 2 155657744 missense probably benign 0.01
R2113:Trpc4ap UTSW 2 155657936 missense probably damaging 0.99
R3810:Trpc4ap UTSW 2 155643435 missense probably damaging 1.00
R4384:Trpc4ap UTSW 2 155640507 missense possibly damaging 0.85
R4664:Trpc4ap UTSW 2 155672997 missense probably benign 0.04
R4690:Trpc4ap UTSW 2 155635133 missense probably damaging 0.97
R5347:Trpc4ap UTSW 2 155672988 critical splice donor site probably null
R5655:Trpc4ap UTSW 2 155653627 missense possibly damaging 0.95
R5689:Trpc4ap UTSW 2 155671035 splice site probably null
R5828:Trpc4ap UTSW 2 155635210 intron probably benign
R5894:Trpc4ap UTSW 2 155666213 missense probably benign 0.11
R6056:Trpc4ap UTSW 2 155671074 missense probably damaging 1.00
R6289:Trpc4ap UTSW 2 155663707 missense possibly damaging 0.90
R6682:Trpc4ap UTSW 2 155637767 critical splice acceptor site probably null
R7022:Trpc4ap UTSW 2 155657822 missense probably benign 0.01
R7031:Trpc4ap UTSW 2 155692215 missense unknown
X0018:Trpc4ap UTSW 2 155653564 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCTAGGAAGAACTGTTTCCAGAAAG -3'
(R):5'- ATTGCATACGCTGAAGAGCC -3'

Sequencing Primer
(F):5'- TTTCCAGAAAGGGAGGAAACCC -3'
(R):5'- TGAAGAGCCACCGTTGTAGGTC -3'
Posted On2019-01-16