Mutagenetix > Incidental Mutations

Incidental Mutation 'R6695:Spdl1'

543489

Institutional Source

Beutler Lab

Gene Symbol

Spdl1

Ensembl Gene

ENSMUSG00000069910

Gene Name

spindle apparatus coiled-coil protein 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.891) question?

Stock #

R6695 (G1)

Quality Score

70.0183

Status

Validated

Chromosome

Chromosomal Location

34809190-34833641 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 34823003 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000090882 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093191]

AlphaFold

Q923A2

Predicted Effect

probably null
Transcript: ENSMUST00000093191

SMART Domains

Protein: ENSMUSP00000090882
Gene: ENSMUSG00000069910

Domain	Start	End	E-Value	Type
coiled coil region	35	342	N/A	INTRINSIC
coiled coil region	370	441	N/A	INTRINSIC
low complexity region	463	478	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein that functions in mitotic spindle formation and chromosome segregation. The encoded protein plays a role in coordinating microtubule attachment by promoting recruitment of dynein proteins, and in mitotic checkpoint signaling. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd9	A	T	12: 110,977,063	L179H	probably benign	Het
Cacna1h	C	A	17: 25,393,740	A370S	probably damaging	Het
Cc2d2a	A	T	5: 43,718,677	I1053F	probably damaging	Het
Csmd3	A	G	15: 47,857,834	V1467A	probably damaging	Het
Cyp4f15	T	A	17: 32,692,612	L156*	probably null	Het
Dmwd	T	A	7: 19,080,727	L434Q	probably damaging	Het
Dtx4	T	A	19: 12,473,235	R538*	probably null	Het
Fcgbp	T	A	7: 28,086,270	C377*	probably null	Het
Galntl6	G	T	8: 58,427,770	H116Q	probably damaging	Het
Herc1	T	A	9: 66,483,866		probably null	Het
Hydin	T	G	8: 110,326,460	S255A	probably benign	Het
Knstrn	G	A	2: 118,814,242	A48T	probably damaging	Het
Lonrf2	T	C	1: 38,813,389	D127G	probably benign	Het
Luzp1	T	C	4: 136,545,298	S12P	possibly damaging	Het
Man2c1	A	T	9: 57,141,591	H822L	probably benign	Het
Map3k13	G	T	16: 21,922,278	G785V	probably benign	Het
Mia2	A	G	12: 59,172,580	H454R	probably damaging	Het
Mib2	G	A	4: 155,661,172	R61C	probably damaging	Het
Muc15	A	T	2: 110,731,271	L17F	probably damaging	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Nav2	A	G	7: 49,464,904	I879V	probably benign	Het
Nomo1	T	A	7: 46,066,461	S751T	probably benign	Het
Olfr1449	A	T	19: 12,935,400	I221L	possibly damaging	Het
Olfr338	A	T	2: 36,377,105	S110C	probably benign	Het
Olfr996	A	G	2: 85,579,449	D70G	probably damaging	Het
Pcdhac2	A	G	18: 37,145,203	N412S	probably benign	Het
Plk5	T	C	10: 80,360,201	S235P	probably benign	Het
Ppm1j	A	G	3: 104,785,486	D437G	probably damaging	Het
Rab11fip1	T	C	8: 27,143,234	E1148G	probably damaging	Het
Rad9b	T	C	5: 122,351,691	N43S	probably damaging	Het
Rc3h2	A	C	2: 37,414,661	I29S	possibly damaging	Het
Rsf1	CG	CGACGGCGGGG	7: 97,579,908		probably benign	Homo
Spta1	A	T	1: 174,244,042		probably null	Het
Stk32c	A	T	7: 139,122,964	V53E	probably damaging	Het
Strc	A	T	2: 121,377,224	F555L	probably benign	Het
Sugct	T	G	13: 17,323,230	N286T	possibly damaging	Het
Swsap1	A	T	9: 21,956,675		probably null	Het
Thbs2	T	A	17: 14,674,164	D807V	possibly damaging	Het
Tnrc6b	A	G	15: 80,879,773	D492G	probably damaging	Het
Tonsl	A	T	15: 76,629,818	S1184T	possibly damaging	Het
Tpp2	T	A	1: 43,983,276	Y945N	probably benign	Het
Usp54	G	T	14: 20,560,869	A1293D	possibly damaging	Het
Vps52	A	T	17: 33,963,199	K516*	probably null	Het
Zbtb17	T	A	4: 141,461,799	V10D	probably damaging	Het
Zfp607b	T	C	7: 27,704,039	V640A	probably benign	Het

Other mutations in Spdl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02417:Spdl1	APN	11	34813354	missense	probably benign	0.27
IGL02694:Spdl1	APN	11	34813621	missense	probably benign	0.05
IGL03131:Spdl1	APN	11	34830765	missense	possibly damaging	0.46
R0295:Spdl1	UTSW	11	34813343	missense	possibly damaging	0.82
R0319:Spdl1	UTSW	11	34823520	missense	possibly damaging	0.66
R1017:Spdl1	UTSW	11	34819290	missense	possibly damaging	0.66
R1195:Spdl1	UTSW	11	34819817	missense	probably damaging	0.97
R1195:Spdl1	UTSW	11	34819817	missense	probably damaging	0.97
R1195:Spdl1	UTSW	11	34819817	missense	probably damaging	0.97
R1296:Spdl1	UTSW	11	34813607	missense	unknown
R1315:Spdl1	UTSW	11	34813407	missense	unknown
R1799:Spdl1	UTSW	11	34821029	nonsense	probably null
R2002:Spdl1	UTSW	11	34822646	missense	probably benign
R2291:Spdl1	UTSW	11	34819309	nonsense	probably null
R4771:Spdl1	UTSW	11	34813327	missense	probably damaging	0.98
R5030:Spdl1	UTSW	11	34823440	missense	probably benign	0.00
R5167:Spdl1	UTSW	11	34813360	missense	possibly damaging	0.79
R5477:Spdl1	UTSW	11	34822210	missense	possibly damaging	0.66
R6258:Spdl1	UTSW	11	34819886	missense	probably damaging	0.97
R6260:Spdl1	UTSW	11	34819886	missense	probably damaging	0.97
R6554:Spdl1	UTSW	11	34822570	missense	possibly damaging	0.82
R6714:Spdl1	UTSW	11	34823003	splice site	probably null
R6980:Spdl1	UTSW	11	34830879	start codon destroyed	probably null	0.04
R7355:Spdl1	UTSW	11	34823364	missense	not run
R7791:Spdl1	UTSW	11	34813477	missense	possibly damaging	0.83
R7844:Spdl1	UTSW	11	34813343	missense	possibly damaging	0.82
R8029:Spdl1	UTSW	11	34822592	missense	probably benign	0.00
R8515:Spdl1	UTSW	11	34813425	missense	possibly damaging	0.92
R8923:Spdl1	UTSW	11	34813651	missense	possibly damaging	0.66
R9005:Spdl1	UTSW	11	34809708	missense	possibly damaging	0.83
Z1176:Spdl1	UTSW	11	34822457	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GGTTGCCAAGTATATCCAAGC -3'
(R):5'- CATGCTGCAGAACTTTCAGGTG -3'

Sequencing Primer
(F):5'- ctctctttctctctttctctct -3'
(R):5'- CCCTGGCGTCATTTATAG -3'

Posted On

2019-01-24