Mutagenetix > Incidental Mutation

Incidental Mutation 'R6595:Dclk2'

543495

Institutional Source

Beutler Lab

Gene Symbol

Dclk2

Ensembl Gene

ENSMUSG00000028078

Gene Name

doublecortin-like kinase 2

Synonyms

Dcamkl2, Click-II, 6330415M09Rik

MMRRC Submission

Accession Numbers

Genbank: NM_027539; MGI: 1918012

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6595 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86786151-86920852 bp(-) (GRCm38)

Type of Mutation

critical splice donor site

DNA Base Change (assembly)

A to G at 86792067 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141567 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029719] [ENSMUST00000191752] [ENSMUST00000192773] [ENSMUST00000193632] [ENSMUST00000195561]

AlphaFold

Q6PGN3

Predicted Effect

silent
Transcript: ENSMUST00000029719

SMART Domains

Protein: ENSMUSP00000029719
Gene: ENSMUSG00000028078

Domain	Start	End	E-Value	Type
low complexity region	18	43	N/A	INTRINSIC
DCX	67	158	2.29e-42	SMART
DCX	191	279	2.17e-34	SMART
low complexity region	291	317	N/A	INTRINSIC
low complexity region	323	346	N/A	INTRINSIC
S_TKc	393	650	4.96e-101	SMART
low complexity region	718	740	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000191752

SMART Domains

Protein: ENSMUSP00000141707
Gene: ENSMUSG00000028078

Domain	Start	End	E-Value	Type
low complexity region	18	43	N/A	INTRINSIC
DCX	67	158	2.29e-42	SMART
DCX	191	279	2.17e-34	SMART
low complexity region	291	317	N/A	INTRINSIC
low complexity region	323	346	N/A	INTRINSIC
S_TKc	393	646	2.4e-76	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000192773

SMART Domains

Protein: ENSMUSP00000141567
Gene: ENSMUSG00000028078

Domain	Start	End	E-Value	Type
low complexity region	18	43	N/A	INTRINSIC
DCX	67	158	1.1e-44	SMART
DCX	191	279	9.9e-37	SMART
low complexity region	291	317	N/A	INTRINSIC
low complexity region	323	346	N/A	INTRINSIC
S_TKc	392	641	8.6e-81	SMART

Predicted Effect

silent
Transcript: ENSMUST00000193632

SMART Domains

Protein: ENSMUSP00000141866
Gene: ENSMUSG00000028078

Domain	Start	End	E-Value	Type
low complexity region	18	43	N/A	INTRINSIC
DCX	67	158	1.1e-44	SMART
DCX	191	279	9.9e-37	SMART
low complexity region	291	317	N/A	INTRINSIC
low complexity region	339	362	N/A	INTRINSIC
S_TKc	409	666	2.4e-103	SMART

Predicted Effect

silent
Transcript: ENSMUST00000195561

SMART Domains

Protein: ENSMUSP00000142267
Gene: ENSMUSG00000028078

Domain	Start	End	E-Value	Type
low complexity region	18	43	N/A	INTRINSIC
DCX	67	158	2.29e-42	SMART
DCX	191	279	2.17e-34	SMART
low complexity region	291	317	N/A	INTRINSIC
low complexity region	323	346	N/A	INTRINSIC
S_TKc	392	649	4.96e-101	SMART
low complexity region	717	739	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.5%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmoduline-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. This gene and the DCX gene, another family member, share function in the establishment of hippocampal organization and their absence results in a severe epileptic phenotype and lethality, as described in human patients with lissencephaly. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2010]

Allele List at MGI

All alleles(59) : Targeted, knock-out(1) Gene trapped(58)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,801,858	D217V	possibly damaging	Het
Abca15	A	T	7: 120,394,487	Y1310F	probably benign	Het
Ankrd54	A	G	15: 79,057,985	F148L	probably damaging	Het
Bag4	C	T	8: 25,769,500	D224N	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Camk2b	A	T	11: 5,992,856	H126Q	probably damaging	Het
Camsap3	G	T	8: 3,604,186	V608L	probably damaging	Het
Camsap3	A	T	8: 3,608,742	M796L	probably damaging	Het
Cdh19	T	C	1: 110,925,787	D308G	probably benign	Het
Cpsf1	T	C	15: 76,602,510	I275M	probably damaging	Het
Cuta	A	G	17: 26,938,882		probably null	Het
Dst	T	G	1: 34,250,680	L784R	probably damaging	Het
Fbn1	T	C	2: 125,342,830	M1681V	possibly damaging	Het
Fbxo9	A	T	9: 78,087,212	D274E	probably damaging	Het
Frem2	T	A	3: 53,549,784	D2049V	probably damaging	Het
Fscn3	T	C	6: 28,430,175	Y115H	probably damaging	Het
Glp2r	G	T	11: 67,764,777	D46E	probably benign	Het
Gm13103	T	C	4: 143,852,756	C304R	probably damaging	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Irx5	A	G	8: 92,359,619	Y110C	probably damaging	Het
Kdm5d	T	C	Y: 939,829	S994P	probably benign	Homo
Klhl2	A	T	8: 64,743,043	C555*	probably null	Het
Krtap4-7	A	T	11: 99,643,734	I101N	unknown	Het
Olfr1308	A	T	2: 111,960,170	V301E	possibly damaging	Het
Olfr60	A	G	7: 140,345,647	L114P	probably damaging	Het
Pcdhb21	T	C	18: 37,515,908	S697P	probably damaging	Het
Rasgrf2	A	T	13: 92,030,853	H237Q	probably damaging	Het
Rnf216	A	T	5: 143,090,657	D157E	probably benign	Het
Rxrg	T	A	1: 167,627,336	F163I	probably damaging	Het
Soat2	T	A	15: 102,160,593	I351N	probably damaging	Het
Srp72	C	T	5: 76,984,200	T242I	probably benign	Het
Svopl	T	C	6: 38,041,067		probably null	Het
Tbc1d2b	G	A	9: 90,226,092	P469S	probably benign	Het
Tbkbp1	G	A	11: 97,138,752		probably benign	Het
Tecta	A	G	9: 42,384,227	V324A	probably damaging	Het
Twnk	T	C	19: 45,010,492	V557A	probably damaging	Het
Vmn2r18	G	A	5: 151,562,424	T535I	probably damaging	Het
Zc3h14	T	A	12: 98,757,026	S85T	probably damaging	Het

Other mutations in Dclk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Dclk2	APN	3	86799090	critical splice acceptor site	probably null
IGL01769:Dclk2	APN	3	86816360	missense	possibly damaging	0.50
IGL01802:Dclk2	APN	3	86799027	missense	probably damaging	1.00
IGL02296:Dclk2	APN	3	86793293	missense	probably damaging	1.00
IGL02390:Dclk2	APN	3	86824683	missense	probably damaging	0.99
IGL02522:Dclk2	APN	3	86920116	missense	probably benign	0.01
IGL03104:Dclk2	APN	3	86836359	missense	probably damaging	1.00
IGL03337:Dclk2	APN	3	86906059	missense	probably damaging	1.00
R0219:Dclk2	UTSW	3	86813669	splice site	probably benign
R0400:Dclk2	UTSW	3	86813747	splice site	probably null
R0606:Dclk2	UTSW	3	86906004	missense	probably damaging	1.00
R1537:Dclk2	UTSW	3	86806184	missense	probably damaging	0.97
R1569:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1571:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1612:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1680:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1689:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1714:Dclk2	UTSW	3	86906093	missense	probably benign	0.00
R1745:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1746:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1752:Dclk2	UTSW	3	86806127	missense	possibly damaging	0.61
R1829:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R2008:Dclk2	UTSW	3	86920035	missense	probably damaging	1.00
R2125:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R2126:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R2132:Dclk2	UTSW	3	86920046	missense	probably benign	0.44
R2314:Dclk2	UTSW	3	86920035	missense	probably damaging	1.00
R2338:Dclk2	UTSW	3	86799017	missense	probably damaging	1.00
R2849:Dclk2	UTSW	3	86793223	missense	probably damaging	1.00
R3108:Dclk2	UTSW	3	86920035	missense	probably damaging	1.00
R3109:Dclk2	UTSW	3	86920035	missense	probably damaging	1.00
R3615:Dclk2	UTSW	3	86920035	missense	probably damaging	1.00
R3616:Dclk2	UTSW	3	86920035	missense	probably damaging	1.00
R4051:Dclk2	UTSW	3	86830822	critical splice donor site	probably null
R4052:Dclk2	UTSW	3	86830822	critical splice donor site	probably null
R4208:Dclk2	UTSW	3	86830822	critical splice donor site	probably null
R4643:Dclk2	UTSW	3	86806180	missense	possibly damaging	0.93
R4654:Dclk2	UTSW	3	86836376	missense	probably damaging	1.00
R4693:Dclk2	UTSW	3	86815093	missense	possibly damaging	0.67
R4716:Dclk2	UTSW	3	86919881	missense	probably damaging	1.00
R4914:Dclk2	UTSW	3	86824742	splice site	probably null
R4915:Dclk2	UTSW	3	86824742	splice site	probably null
R4917:Dclk2	UTSW	3	86824742	splice site	probably null
R5218:Dclk2	UTSW	3	86805678	missense	probably damaging	1.00
R5510:Dclk2	UTSW	3	86906037	missense	possibly damaging	0.93
R5520:Dclk2	UTSW	3	86919840	missense	probably damaging	1.00
R5867:Dclk2	UTSW	3	86791859	makesense	probably null
R5976:Dclk2	UTSW	3	86787225	missense	possibly damaging	0.53
R6048:Dclk2	UTSW	3	86905965	missense	probably damaging	1.00
R6111:Dclk2	UTSW	3	86805661	missense	probably benign	0.28
R6192:Dclk2	UTSW	3	86815150	missense	probably damaging	1.00
R6289:Dclk2	UTSW	3	86831817	missense	probably benign	0.18
R6897:Dclk2	UTSW	3	86831763	missense	probably benign	0.00
R7061:Dclk2	UTSW	3	86831731	critical splice donor site	probably null
R7095:Dclk2	UTSW	3	86793259	missense	probably damaging	1.00
R7096:Dclk2	UTSW	3	86793259	missense	probably damaging	1.00
R7208:Dclk2	UTSW	3	86799602	splice site	probably null
R7253:Dclk2	UTSW	3	86793259	missense	probably damaging	1.00
R7256:Dclk2	UTSW	3	86793259	missense	probably damaging	1.00
R8003:Dclk2	UTSW	3	86793301	critical splice acceptor site	probably null
R8061:Dclk2	UTSW	3	86813674	splice site	probably benign
R8927:Dclk2	UTSW	3	86831741	missense	probably damaging	1.00
R8928:Dclk2	UTSW	3	86831741	missense	probably damaging	1.00
R8964:Dclk2	UTSW	3	86836391	missense	probably damaging	1.00
R9704:Dclk2	UTSW	3	86920080	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- ATGCCAGGCAATCCTCCATG -3'
(R):5'- TGGCAGCAGTTAGTTTTGAAAGAAC -3'

Sequencing Primer
(F):5'- AGGAACATGGAAGACACCAGCTTC -3'
(R):5'- GAACTAAACTTGTGTTCTTCTGGC -3'

Posted On

2019-01-30