Incidental Mutation 'R6714:Spdl1'
ID543500
Institutional Source Beutler Lab
Gene Symbol Spdl1
Ensembl Gene ENSMUSG00000069910
Gene Namespindle apparatus coiled-coil protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock #R6714 (G1)
Quality Score70.0074
Status Validated
Chromosome11
Chromosomal Location34809190-34833641 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 34823003 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093191]
Predicted Effect probably null
Transcript: ENSMUST00000093191
SMART Domains Protein: ENSMUSP00000090882
Gene: ENSMUSG00000069910

DomainStartEndE-ValueType
coiled coil region 35 342 N/A INTRINSIC
coiled coil region 370 441 N/A INTRINSIC
low complexity region 463 478 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein that functions in mitotic spindle formation and chromosome segregation. The encoded protein plays a role in coordinating microtubule attachment by promoting recruitment of dynein proteins, and in mitotic checkpoint signaling. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC061237 A T 14: 44,504,182 R127S possibly damaging Het
Bub1 C A 2: 127,814,732 M463I probably benign Het
Cdh23 T C 10: 60,331,830 I1794V possibly damaging Het
Clspn C T 4: 126,565,768 T320M probably damaging Het
Coch A C 12: 51,602,737 D277A probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Dnah7c A T 1: 46,740,806 I3223F probably damaging Het
E2f6 G A 12: 16,819,002 V109I probably damaging Het
Edem2 A T 2: 155,728,889 probably null Het
Efcab8 A G 2: 153,789,210 K187E probably damaging Het
Fam184a T C 10: 53,698,883 N210S probably benign Het
Fam208b A T 13: 3,594,189 F143L probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,979,534 I2066V probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm9992 T G 17: 7,376,538 E124A probably benign Het
Gpc5 C T 14: 115,552,303 Q530* probably null Het
Hmcn1 A T 1: 150,704,175 I1937K probably damaging Het
Hpx G A 7: 105,595,095 R269C probably damaging Het
Ice1 T C 13: 70,615,263 probably null Het
Kbtbd4 A T 2: 90,905,839 probably null Het
Ldlrad3 T C 2: 101,952,952 T310A probably benign Het
Lrp4 G A 2: 91,476,365 S341N possibly damaging Het
Map3k3 T C 11: 106,114,222 V69A possibly damaging Het
Myh8 T C 11: 67,306,949 Y1881H probably damaging Het
Nectin4 A T 1: 171,370,650 probably benign Het
Nhsl1 G T 10: 18,524,711 V562L possibly damaging Het
Olfr729 A T 14: 50,148,214 I220K possibly damaging Het
Olfr775 T A 10: 129,250,940 N135K possibly damaging Het
Pcdhga7 T A 18: 37,717,277 V779E probably benign Het
Peg12 T A 7: 62,463,569 H260L unknown Het
Qrfpr A T 3: 36,180,256 M312K possibly damaging Het
Rbl2 T A 8: 91,106,787 I730N possibly damaging Het
Rbm39 G C 2: 156,161,618 L281V possibly damaging Het
Setd1b A G 5: 123,157,591 E1074G unknown Het
Sfr1 A G 19: 47,734,966 D303G probably damaging Het
Slc7a12 T C 3: 14,481,320 V175A probably benign Het
Slc8a1 A T 17: 81,408,249 L785Q probably damaging Het
Spg11 T C 2: 122,095,731 I694M probably damaging Het
Trpc1 A T 9: 95,723,273 L111Q probably damaging Het
Tti1 A G 2: 158,007,051 V756A possibly damaging Het
Usp32 A T 11: 85,026,870 I777N probably damaging Het
Zbtb8b C T 4: 129,432,983 E97K probably damaging Het
Zfhx4 A G 3: 5,241,837 D41G probably damaging Het
Zfp493 A T 13: 67,786,380 S151C probably benign Het
Zfp503 T C 14: 21,985,757 T364A probably benign Het
Zfp507 T C 7: 35,787,727 K772R probably damaging Het
Zfp804b T A 5: 6,769,239 M1275L probably benign Het
Zfp811 G A 17: 32,797,762 H434Y probably damaging Het
Other mutations in Spdl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02417:Spdl1 APN 11 34813354 missense probably benign 0.27
IGL02694:Spdl1 APN 11 34813621 missense probably benign 0.05
IGL03131:Spdl1 APN 11 34830765 missense possibly damaging 0.46
R0295:Spdl1 UTSW 11 34813343 missense possibly damaging 0.82
R0319:Spdl1 UTSW 11 34823520 missense possibly damaging 0.66
R1017:Spdl1 UTSW 11 34819290 missense possibly damaging 0.66
R1195:Spdl1 UTSW 11 34819817 missense probably damaging 0.97
R1195:Spdl1 UTSW 11 34819817 missense probably damaging 0.97
R1195:Spdl1 UTSW 11 34819817 missense probably damaging 0.97
R1296:Spdl1 UTSW 11 34813607 missense unknown
R1315:Spdl1 UTSW 11 34813407 missense unknown
R1799:Spdl1 UTSW 11 34821029 nonsense probably null
R2002:Spdl1 UTSW 11 34822646 missense probably benign
R2291:Spdl1 UTSW 11 34819309 nonsense probably null
R4771:Spdl1 UTSW 11 34813327 missense probably damaging 0.98
R5030:Spdl1 UTSW 11 34823440 missense probably benign 0.00
R5167:Spdl1 UTSW 11 34813360 missense possibly damaging 0.79
R5477:Spdl1 UTSW 11 34822210 missense possibly damaging 0.66
R6258:Spdl1 UTSW 11 34819886 missense probably damaging 0.97
R6260:Spdl1 UTSW 11 34819886 missense probably damaging 0.97
R6554:Spdl1 UTSW 11 34822570 missense possibly damaging 0.82
R6695:Spdl1 UTSW 11 34823003 intron probably null
R6980:Spdl1 UTSW 11 34830879 start codon destroyed probably null 0.04
R7355:Spdl1 UTSW 11 34823364 missense not run
R7791:Spdl1 UTSW 11 34813477 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TAAGGTTGCCAAGTATATCCAAGC -3'
(R):5'- GCTGCAGAACTTTCAGGTGGAC -3'

Sequencing Primer
(F):5'- ctctctttctctctttctctct -3'
(R):5'- CCCTGGCGTCATTTATAG -3'
Posted On2019-01-30