Incidental Mutation 'R6629:Nek1'
ID543507
Institutional Source Beutler Lab
Gene Symbol Nek1
Ensembl Gene ENSMUSG00000031644
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 1
Synonymskidney, anemia and testis, kat, D8Ertd790e
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_175089.3; MGI: 97303

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6629 (G1)
Quality Score72.0074
Status Validated
Chromosome8
Chromosomal Location60993195-61131346 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 61054333 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034065] [ENSMUST00000120689] [ENSMUST00000211256] [ENSMUST00000211672]
Predicted Effect probably null
Transcript: ENSMUST00000034065
SMART Domains Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 556 592 N/A INTRINSIC
coiled coil region 647 685 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120689
SMART Domains Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 487 510 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
coiled coil region 584 620 N/A INTRINSIC
coiled coil region 675 713 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
low complexity region 1158 1169 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000211256
Predicted Effect probably null
Transcript: ENSMUST00000211672
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 97% (38/39)
MGI Phenotype Strain: 1858030; 1858122
Lethality: D14-D365
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Spontaneous mutations of this gene result in pleiotropic effects that include facial dysmorphism, dwarfism, male sterility, anemia, cystic choroid plexus, a late-onset slowly progressive polycystic kidney disease, and premature death. Postnatal survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(1) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,780 S219P possibly damaging Het
Atxn3 A T 12: 101,937,406 M180K probably benign Het
Bnip2 G T 9: 70,002,111 R236L probably null Het
Boc T C 16: 44,492,361 D582G probably benign Het
Cacul1 T C 19: 60,580,367 S118G probably benign Het
Cpa2 A T 6: 30,554,194 D271V probably damaging Het
Cubn G A 2: 13,430,872 T1091M probably damaging Het
Dlgap2 A G 8: 14,831,465 T846A probably benign Het
Eif5 G T 12: 111,543,608 A329S probably damaging Het
Fam136b-ps G A 15: 31,276,816 probably benign Het
Gnrhr A G 5: 86,182,309 V284A probably benign Het
Grin3a A G 4: 49,844,991 S31P probably damaging Het
Hectd2 T C 19: 36,615,538 L701P probably damaging Het
Hook1 C T 4: 96,001,270 T241I probably benign Het
Kif5a A G 10: 127,248,254 V52A probably damaging Het
Lasp1 T A 11: 97,806,896 Y11* probably null Het
Meltf A G 16: 31,885,076 Y207C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT 4: 87,841,267 probably benign Het
Notch2 C A 3: 98,120,881 N969K possibly damaging Het
Olfr1221 T A 2: 89,112,162 M117L probably benign Het
Pcnx2 C T 8: 125,891,112 G135R probably benign Het
Pla2g4f A T 2: 120,308,242 L242Q probably damaging Het
Plcxd2 T G 16: 45,965,107 T312P probably damaging Het
Prpf4 G A 4: 62,417,860 V275I possibly damaging Het
Prpf8 G A 11: 75,495,426 probably null Het
Pxn T C 5: 115,554,062 L401P probably damaging Het
Rab44 A T 17: 29,135,780 probably benign Het
Rfx6 C A 10: 51,725,490 T669K probably benign Het
Rgs16 A G 1: 153,743,674 N142S probably damaging Het
Rhobtb1 A G 10: 69,270,316 E237G possibly damaging Het
Rsbn1 A C 3: 103,928,441 D265A probably damaging Het
Rufy4 A G 1: 74,132,367 probably null Het
Slc4a1 C A 11: 102,361,222 E19* probably null Het
Tctn1 A G 5: 122,242,668 S526P probably damaging Het
Tspear A T 10: 77,870,509 H371L probably benign Het
Vmn1r34 A T 6: 66,637,515 F80I probably benign Het
Wdr75 G A 1: 45,812,056 S264N probably damaging Het
Zfp652 A T 11: 95,763,790 N340Y probably damaging Het
Zp3 A G 5: 135,987,336 T306A probably benign Het
Other mutations in Nek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Nek1 APN 8 61043284 missense probably benign 0.00
IGL01075:Nek1 APN 8 61124132 missense possibly damaging 0.64
IGL01122:Nek1 APN 8 61120966 missense possibly damaging 0.80
IGL01151:Nek1 APN 8 61020077 missense probably damaging 1.00
IGL01286:Nek1 APN 8 61124216 missense possibly damaging 0.64
IGL01377:Nek1 APN 8 61089456 missense probably benign
IGL01485:Nek1 APN 8 61049826 missense probably benign 0.02
IGL01688:Nek1 APN 8 61105597 nonsense probably null
IGL01806:Nek1 APN 8 61124212 missense possibly damaging 0.82
IGL02006:Nek1 APN 8 61104192 missense probably benign 0.20
IGL02304:Nek1 APN 8 61012167 missense probably damaging 1.00
IGL02659:Nek1 APN 8 61089480 missense probably benign 0.16
IGL02662:Nek1 APN 8 61104184 missense probably benign 0.00
IGL02801:Nek1 APN 8 61121061 critical splice donor site probably null
IGL02806:Nek1 APN 8 61044086 missense probably benign 0.15
IGL03037:Nek1 APN 8 61034052 missense probably benign 0.16
IGL03252:Nek1 APN 8 61072330 nonsense probably null
P0014:Nek1 UTSW 8 61071747 splice site probably benign
R0019:Nek1 UTSW 8 61089734 missense probably benign 0.01
R0403:Nek1 UTSW 8 61106855 missense probably damaging 0.99
R0464:Nek1 UTSW 8 61072273 splice site probably benign
R0726:Nek1 UTSW 8 61089592 missense probably damaging 1.00
R0761:Nek1 UTSW 8 61089455 missense probably benign
R0827:Nek1 UTSW 8 61105648 splice site probably benign
R0972:Nek1 UTSW 8 61089431 splice site probably null
R1268:Nek1 UTSW 8 61022264 missense probably damaging 1.00
R1343:Nek1 UTSW 8 61028675 missense probably damaging 1.00
R1415:Nek1 UTSW 8 61089686 missense probably benign 0.00
R1466:Nek1 UTSW 8 61125136 splice site probably benign
R1480:Nek1 UTSW 8 61124326 splice site probably null
R1526:Nek1 UTSW 8 61049941 missense probably benign 0.26
R1552:Nek1 UTSW 8 61006737 missense probably damaging 0.99
R1606:Nek1 UTSW 8 61124276 missense possibly damaging 0.82
R1650:Nek1 UTSW 8 61036076 missense probably benign 0.00
R1757:Nek1 UTSW 8 61089813 splice site probably null
R1808:Nek1 UTSW 8 61016230 missense probably damaging 1.00
R1966:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R2067:Nek1 UTSW 8 61007162 missense probably damaging 1.00
R2111:Nek1 UTSW 8 61124326 splice site probably null
R2113:Nek1 UTSW 8 61016293 missense probably damaging 1.00
R2143:Nek1 UTSW 8 61028696 missense probably damaging 1.00
R2255:Nek1 UTSW 8 61089773 missense probably damaging 1.00
R2422:Nek1 UTSW 8 61019901 missense probably damaging 1.00
R3848:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3849:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3850:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R4418:Nek1 UTSW 8 61106864 missense probably damaging 1.00
R4526:Nek1 UTSW 8 61106944 missense probably damaging 0.99
R4533:Nek1 UTSW 8 61007213 missense possibly damaging 0.95
R4544:Nek1 UTSW 8 61016304 nonsense probably null
R4677:Nek1 UTSW 8 61028806 missense probably damaging 0.99
R4739:Nek1 UTSW 8 61098511 missense probably benign 0.32
R5068:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R5421:Nek1 UTSW 8 61006677 missense possibly damaging 0.81
R5516:Nek1 UTSW 8 61089489 missense probably benign 0.03
R5855:Nek1 UTSW 8 61016272 missense probably damaging 1.00
R6125:Nek1 UTSW 8 61028701 missense probably damaging 1.00
R6267:Nek1 UTSW 8 61072309 nonsense probably null
R6292:Nek1 UTSW 8 61054736 intron probably null
R6296:Nek1 UTSW 8 61072309 nonsense probably null
R6458:Nek1 UTSW 8 61100012 missense probably benign 0.00
R6568:Nek1 UTSW 8 61106821 missense probably benign 0.00
R6867:Nek1 UTSW 8 61072330 missense possibly damaging 0.81
R7122:Nek1 UTSW 8 61106795 missense probably benign 0.00
R7193:Nek1 UTSW 8 61073578 missense probably damaging 0.99
R7272:Nek1 UTSW 8 61125086 missense probably benign 0.34
R7356:Nek1 UTSW 8 61120960 missense probably benign 0.02
R7368:Nek1 UTSW 8 61089707 missense probably benign 0.24
R7478:Nek1 UTSW 8 61130145 missense probably benign 0.03
R7479:Nek1 UTSW 8 61130145 missense probably benign 0.03
R7512:Nek1 UTSW 8 61130145 missense probably benign 0.03
R7715:Nek1 UTSW 8 61006760 missense probably damaging 0.98
X0028:Nek1 UTSW 8 61043258 missense probably benign 0.19
X0066:Nek1 UTSW 8 61125128 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGGGTTACATCTGTGCAC -3'
(R):5'- ATCACAGAGTCAGCAATTTTCAGC -3'

Sequencing Primer
(F):5'- GTTTCTCACGCTGACTGACACAG -3'
(R):5'- CAGCAATTTTCAGCATTAAATTCCAC -3'
Posted On2019-02-04