Incidental Mutation 'R6640:Hoxd1'
ID543512
Institutional Source Beutler Lab
Gene Symbol Hoxd1
Ensembl Gene ENSMUSG00000042448
Gene Namehomeobox D1
SynonymsHox-4.9
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R6640 (G1)
Quality Score50.0072
Status Validated
Chromosome2
Chromosomal Location74762980-74765142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74763262 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 54 (V54E)
Ref Sequence ENSEMBL: ENSMUSP00000043078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047793]
Predicted Effect probably damaging
Transcript: ENSMUST00000047793
AA Change: V54E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043078
Gene: ENSMUSG00000042448
AA Change: V54E

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
low complexity region 57 84 N/A INTRINSIC
low complexity region 140 150 N/A INTRINSIC
HOX 229 291 1.37e-24 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Antp homeobox family and encodes a protein with a homeobox DNA-binding domain. This nuclear protein functions as a sequence-specific transcription factor that is involved in differentiation and limb development. Mutations in this gene have been associated with severe developmental defects on the anterior-posterior (a-p) limb axis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele display abnormal cervical vertebrae. Mice homozygous for a knock-out allele exhibit abnormal nociceptor innervation of the skin, aberrant nociceptor axonal projections in the spinal cord, and deficits in pain sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,553,285 N936K probably benign Het
Abca2 A T 2: 25,447,003 Y2318F possibly damaging Het
Aldh1b1 A G 4: 45,803,868 T469A possibly damaging Het
Ccdc136 A G 6: 29,412,960 D382G possibly damaging Het
Dapk1 A G 13: 60,716,814 K141E probably damaging Het
Dnah6 A T 6: 73,024,293 W3973R probably damaging Het
Dock10 G T 1: 80,533,838 S1518* probably null Het
Doxl2 A G 6: 48,977,671 D581G probably benign Het
Elovl5 C A 9: 77,979,913 Y195* probably null Het
Fbxl21 T A 13: 56,537,009 W309R probably damaging Het
Gm10020 G T 15: 52,477,620 noncoding transcript Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gpx1 A G 9: 108,340,096 D133G probably damaging Het
Kcnh3 T C 15: 99,241,768 V876A probably benign Het
Klri2 G C 6: 129,732,195 F231L probably benign Het
Mogat1 T G 1: 78,523,774 S158R probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfr1008 T A 2: 85,689,935 C169S probably damaging Het
Olfr695 T A 7: 106,714,040 I214F probably damaging Het
Otog G A 7: 46,261,743 A673T possibly damaging Het
Pigm T C 1: 172,377,687 V330A probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Raver2 C T 4: 101,131,303 P371L probably damaging Het
Sh3rf2 T A 18: 42,101,640 Y163N probably damaging Het
Slc1a1 T C 19: 28,894,570 probably null Het
Slc6a18 T A 13: 73,664,282 Y563F possibly damaging Het
Sp3 A G 2: 72,971,114 L185P possibly damaging Het
Thbs2 T C 17: 14,673,368 D850G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmtc2 T A 10: 105,573,749 M1L probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Trpm3 T A 19: 22,978,582 I1126K probably damaging Het
Ugt1a6b A C 1: 88,107,794 T285P probably benign Het
Vps13b A G 15: 35,617,696 T1181A possibly damaging Het
Other mutations in Hoxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1699:Hoxd1 UTSW 2 74764282 missense probably benign 0.35
R1830:Hoxd1 UTSW 2 74763522 missense probably damaging 1.00
R2008:Hoxd1 UTSW 2 74764180 missense possibly damaging 0.91
R2067:Hoxd1 UTSW 2 74763366 missense probably benign 0.09
R2111:Hoxd1 UTSW 2 74763366 missense probably benign 0.09
R2273:Hoxd1 UTSW 2 74764157 missense probably damaging 1.00
R2274:Hoxd1 UTSW 2 74764157 missense probably damaging 1.00
R2275:Hoxd1 UTSW 2 74764157 missense probably damaging 1.00
R5216:Hoxd1 UTSW 2 74764351 missense probably damaging 0.97
R5242:Hoxd1 UTSW 2 74763448 missense probably damaging 0.99
R7359:Hoxd1 UTSW 2 74764103 missense probably damaging 1.00
R7442:Hoxd1 UTSW 2 74763559 missense probably damaging 1.00
R7836:Hoxd1 UTSW 2 74763472 missense probably benign 0.25
R7942:Hoxd1 UTSW 2 74764160 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTATTTACCTCGGGCTCGC -3'
(R):5'- GCCGCTGAGCAGGAATGATC -3'

Sequencing Primer
(F):5'- GCCTAGGTCGTGCGGAG -3'
(R):5'- CCGAGGTGGCATAGTGGAC -3'
Posted On2019-02-13