Incidental Mutation 'R6640:Rab33b'
ID543513
Institutional Source Beutler Lab
Gene Symbol Rab33b
Ensembl Gene ENSMUSG00000027739
Gene NameRAB33B, member RAS oncogene family
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R6640 (G1)
Quality Score46.0072
Status Validated
Chromosome3
Chromosomal Location51483920-51496232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51484479 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 50 (T50A)
Ref Sequence ENSEMBL: ENSMUSP00000142215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054387] [ENSMUST00000192172]
Predicted Effect probably benign
Transcript: ENSMUST00000054387
AA Change: T50A

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000063054
Gene: ENSMUSG00000027739
AA Change: T50A

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
RAB 34 202 1.94e-85 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192172
AA Change: T50A

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142215
Gene: ENSMUSG00000027739
AA Change: T50A

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
Pfam:Ras 35 65 7.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195715
Meta Mutation Damage Score 0.1414 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small GTP-binding protein of the Rab GTPase family, whose members function in vesicle transport during protein secretion and endocytosis. Rab GTPases are active, membrane-associated proteins that recruit effector proteins in the GTP-bound state and inactive cytosolic proteins when in a GDP-bound state. The protein encoded by this gene is ubiquitously expressed and has been implicated in Golgi to endoplasmic reticulum cycling of Golgi enzymes. In addition, this protein regulates Golgi homeostasis and coordinates intra-Golgi retrograde trafficking. Allelic variants in this gene have been associated with Dyggve-Melchior-Clausen syndrome and Smith-McCort dysplasia 2, which are autosomal recessive spondyloepimetaphyseal dysplasias characterized by skeletal abnormalities. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,553,285 N936K probably benign Het
Abca2 A T 2: 25,447,003 Y2318F possibly damaging Het
Aldh1b1 A G 4: 45,803,868 T469A possibly damaging Het
Ccdc136 A G 6: 29,412,960 D382G possibly damaging Het
Dapk1 A G 13: 60,716,814 K141E probably damaging Het
Dnah6 A T 6: 73,024,293 W3973R probably damaging Het
Dock10 G T 1: 80,533,838 S1518* probably null Het
Doxl2 A G 6: 48,977,671 D581G probably benign Het
Elovl5 C A 9: 77,979,913 Y195* probably null Het
Fbxl21 T A 13: 56,537,009 W309R probably damaging Het
Gm10020 G T 15: 52,477,620 noncoding transcript Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gpx1 A G 9: 108,340,096 D133G probably damaging Het
Hoxd1 T A 2: 74,763,262 V54E probably damaging Het
Kcnh3 T C 15: 99,241,768 V876A probably benign Het
Klri2 G C 6: 129,732,195 F231L probably benign Het
Mogat1 T G 1: 78,523,774 S158R probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfr1008 T A 2: 85,689,935 C169S probably damaging Het
Olfr695 T A 7: 106,714,040 I214F probably damaging Het
Otog G A 7: 46,261,743 A673T possibly damaging Het
Pigm T C 1: 172,377,687 V330A probably damaging Het
Raver2 C T 4: 101,131,303 P371L probably damaging Het
Sh3rf2 T A 18: 42,101,640 Y163N probably damaging Het
Slc1a1 T C 19: 28,894,570 probably null Het
Slc6a18 T A 13: 73,664,282 Y563F possibly damaging Het
Sp3 A G 2: 72,971,114 L185P possibly damaging Het
Thbs2 T C 17: 14,673,368 D850G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmtc2 T A 10: 105,573,749 M1L probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Trpm3 T A 19: 22,978,582 I1126K probably damaging Het
Ugt1a6b A C 1: 88,107,794 T285P probably benign Het
Vps13b A G 15: 35,617,696 T1181A possibly damaging Het
Other mutations in Rab33b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02756:Rab33b APN 3 51484524 missense probably damaging 1.00
R0012:Rab33b UTSW 3 51484316 start gained probably benign
R0690:Rab33b UTSW 3 51493417 missense probably damaging 1.00
R1027:Rab33b UTSW 3 51484455 missense probably damaging 1.00
R3151:Rab33b UTSW 3 51493648 missense possibly damaging 0.83
R5259:Rab33b UTSW 3 51484612 unclassified probably benign
R5387:Rab33b UTSW 3 51493455 missense probably damaging 1.00
R5650:Rab33b UTSW 3 51493416 missense probably damaging 1.00
R5997:Rab33b UTSW 3 51484479 missense possibly damaging 0.80
R6318:Rab33b UTSW 3 51493405 missense probably damaging 0.99
Z1177:Rab33b UTSW 3 51484334 start codon destroyed probably null 0.01
Predicted Primers PCR Primer
(F):5'- CGTTTGTCACTGCTAGGGAG -3'
(R):5'- GAGGAACAATGCCTCAGAAGTTTG -3'

Sequencing Primer
(F):5'- TGGCGTGGCGTCATTCC -3'
(R):5'- CAATGCCTCAGAAGTTTGATAGATAC -3'
Posted On2019-02-13