Incidental Mutation 'R6526:Cops6'
ID543520
Institutional Source Beutler Lab
Gene Symbol Cops6
Ensembl Gene ENSMUSG00000019494
Gene NameCOP9 signalosome subunit 6
SynonymsSgn3, VIP/MOV34, COP9 complex S6
MMRRC Submission
Accession Numbers

Genbank: NM_012002; MGI: 1349439

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6526 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location138161071-138164646 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 138163900 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110951] [ENSMUST00000132639]
Predicted Effect probably null
Transcript: ENSMUST00000110951
SMART Domains Protein: ENSMUSP00000106576
Gene: ENSMUSG00000019494

DomainStartEndE-ValueType
JAB_MPN 10 143 9.73e-35 SMART
Pfam:MitMem_reg 163 279 2.6e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000132639
SMART Domains Protein: ENSMUSP00000121554
Gene: ENSMUSG00000019494

DomainStartEndE-ValueType
Pfam:MitMem_reg 17 112 3.6e-23 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the eight subunits of COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. This protein belongs to translation initiation factor 3 (eIF3) superfamily. It is involved in the regulation of cell cycle and likely to be a cellular cofactor for HIV-1 accessory gene product Vpr. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele or a transgenic gene disruption exhibit embryonic lethality. Mice heterozygous for a gene trap allele exhibit increased sensitivity to irradiation and decreased incidence of ionizing radiation-induced tumors. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Gene trapped(15)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,172 probably null Het
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anapc1 T A 2: 128,672,135 K429* probably null Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp11a T C 8: 12,864,999 L1139P probably benign Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Cd63 T C 10: 128,911,489 V35A probably benign Het
Chek2 T C 5: 110,848,690 F173L probably damaging Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cog4 T C 8: 110,881,786 L738P probably damaging Het
Cpeb1 T A 7: 81,361,669 I175F probably benign Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elf5 A G 2: 103,439,233 Y53C probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Kdm2b C A 5: 122,961,469 V136F probably damaging Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Mum1 A G 10: 80,232,279 T86A probably benign Het
Nbas A T 12: 13,405,425 L1213F probably damaging Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Olfr476 A G 7: 107,967,462 T22A probably benign Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pitx2 T C 3: 129,214,783 probably null Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Polr1a C A 6: 71,929,443 D414E possibly damaging Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trmt13 T A 3: 116,592,215 N31I probably damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Uqcc1 A G 2: 155,851,423 F197S probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Vmn2r44 A T 7: 8,378,099 M265K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Cops6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Cops6 APN 5 138163378 missense probably damaging 1.00
IGL00929:Cops6 APN 5 138161386 start codon destroyed probably null 0.02
IGL01122:Cops6 APN 5 138162373 missense probably benign 0.42
IGL02652:Cops6 APN 5 138161438 splice site probably null
R0593:Cops6 UTSW 5 138163580 missense probably benign 0.18
R2271:Cops6 UTSW 5 138161141 missense probably benign 0.00
R5011:Cops6 UTSW 5 138162197 missense probably benign 0.00
R5294:Cops6 UTSW 5 138161116 unclassified probably benign
R5394:Cops6 UTSW 5 138163500 splice site probably null
R6225:Cops6 UTSW 5 138161411 missense possibly damaging 0.91
R6943:Cops6 UTSW 5 138163528 missense probably benign 0.43
R7242:Cops6 UTSW 5 138163580 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TTCCCTCCCAGCAATGCAATG -3'
(R):5'- TCTACTTCAACAAGGGGTCACC -3'

Sequencing Primer
(F):5'- TCCCAGCAATGCAATGACGTG -3'
(R):5'- GTCACCTCGAGTCATTAAAAGGTG -3'
Posted On2019-02-15