Mutagenetix > Incidental Mutations

Incidental Mutation 'R6526:Arhgef15'

543521

Institutional Source

Beutler Lab

Gene Symbol

Arhgef15

Ensembl Gene

ENSMUSG00000052921

Gene Name

Rho guanine nucleotide exchange factor (GEF) 15

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6526 (G1)

Quality Score

72.0074

Status

Validated

Chromosome

Chromosomal Location

68943155-68957480 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 68949994 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 569 (T569A)

Ref Sequence

ENSEMBL: ENSMUSP00000104311 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065040] [ENSMUST00000108671]

Predicted Effect

probably damaging
Transcript: ENSMUST00000065040
AA Change: T569A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067684
Gene: ENSMUSG00000052921
AA Change: T569A

Domain	Start	End	E-Value	Type
low complexity region	6	36	N/A	INTRINSIC
low complexity region	65	79	N/A	INTRINSIC
low complexity region	84	127	N/A	INTRINSIC
low complexity region	202	221	N/A	INTRINSIC
low complexity region	275	285	N/A	INTRINSIC
low complexity region	335	349	N/A	INTRINSIC
RhoGEF	429	608	1.76e-50	SMART
low complexity region	670	680	N/A	INTRINSIC
Blast:RhoGEF	688	746	1e-22	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000108671
AA Change: T569A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000104311
Gene: ENSMUSG00000052921
AA Change: T569A

Domain	Start	End	E-Value	Type
low complexity region	6	36	N/A	INTRINSIC
low complexity region	65	79	N/A	INTRINSIC
low complexity region	84	127	N/A	INTRINSIC
low complexity region	202	221	N/A	INTRINSIC
low complexity region	275	285	N/A	INTRINSIC
low complexity region	335	349	N/A	INTRINSIC
RhoGEF	429	608	1.76e-50	SMART
low complexity region	670	680	N/A	INTRINSIC
Blast:RhoGEF	688	746	1e-22	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein-coupled receptors. This gene encodes a protein that functions as a specific guanine nucleotide exchange factor for RhoA. It also interacts with ephrin A4 in vascular smooth muscle cells. Two alternatively spliced transcripts variants that encode the same protein have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock out allele exhibit increased excitatory synapse formation. Mice homozygous for a knock-out allele exhibit delayed radial growth, sparse vasculature and empty baselment membrane sleeves in the retina. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aamp	A	G	1: 74,284,172		probably null	Het
Abcc3	C	T	11: 94,359,372	G975D	probably benign	Het
Abhd13	G	A	8: 9,987,777	G125S	probably damaging	Het
Ache	T	A	5: 137,290,644	L204Q	probably damaging	Het
Acnat2	A	G	4: 49,383,497	S19P	probably benign	Het
Adprh	A	G	16: 38,447,276	Y216H	probably benign	Het
Anapc1	T	A	2: 128,672,135	K429*	probably null	Het
Anxa13	T	C	15: 58,344,957		noncoding transcript	Het
Aprt	A	C	8: 122,576,816	L6W	probably damaging	Het
Atp11a	T	C	8: 12,864,999	L1139P	probably benign	Het
Atp2b4	A	G	1: 133,711,729	S1136P	probably damaging	Het
B9d1	T	A	11: 61,509,097	Y90*	probably null	Het
Btla	G	A	16: 45,239,094	A54T	probably damaging	Het
Cd63	T	C	10: 128,911,489	V35A	probably benign	Het
Chek2	T	C	5: 110,848,690	F173L	probably damaging	Het
Cntnap3	T	A	13: 64,781,888	N499I	possibly damaging	Het
Cog4	T	C	8: 110,881,786	L738P	probably damaging	Het
Cops6	T	C	5: 138,163,900		probably null	Het
Cpeb1	T	A	7: 81,361,669	I175F	probably benign	Het
Cyp3a16	C	T	5: 145,455,895	D174N	probably benign	Het
Dnah6	T	G	6: 73,074,704	I2984L	probably benign	Het
Dock10	A	T	1: 80,586,351	I540N	probably damaging	Het
Elf5	A	G	2: 103,439,233	Y53C	probably damaging	Het
Elmod2	T	C	8: 83,319,457	T164A	probably damaging	Het
Epn3	A	G	11: 94,494,932		probably null	Het
Fam151a	A	T	4: 106,734,004	I15F	possibly damaging	Het
Gm11115	T	A	5: 88,154,050		probably null	Het
Gm13103	A	G	4: 143,852,814	D323G	probably damaging	Het
Golga3	T	A	5: 110,204,895	I884N	probably damaging	Het
Gria2	A	T	3: 80,692,469	F703I	probably damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Gtpbp2	A	T	17: 46,164,111		probably null	Het
Herc2	T	C	7: 56,157,330	S2419P	probably damaging	Het
Ikbkap	T	C	4: 56,798,812		probably null	Het
Inpp5d	T	C	1: 87,676,250		probably benign	Het
Kdm2b	C	A	5: 122,961,469	V136F	probably damaging	Het
Klra2	T	A	6: 131,221,876	D234V	probably benign	Het
Lct	A	T	1: 128,300,478	S1093T	probably benign	Het
March9	A	G	10: 127,056,689	L310P	probably benign	Het
Morc1	G	T	16: 48,587,124	E668*	probably null	Het
Mum1	A	G	10: 80,232,279	T86A	probably benign	Het
Nbas	A	T	12: 13,405,425	L1213F	probably damaging	Het
Neto1	A	G	18: 86,498,748	T397A	possibly damaging	Het
Oit3	A	G	10: 59,429,640	C268R	probably damaging	Het
Olfr476	A	G	7: 107,967,462	T22A	probably benign	Het
Pcx	T	C	19: 4,604,495	F312L	probably benign	Het
Pitx2	T	C	3: 129,214,783		probably null	Het
Pkhd1l1	G	A	15: 44,498,089		probably null	Het
Polr1a	C	A	6: 71,929,443	D414E	possibly damaging	Het
Prkch	T	C	12: 73,702,775	Y381H	probably damaging	Het
Ptger3	T	A	3: 157,567,502	V162E	probably damaging	Het
Ptgr2	T	G	12: 84,313,952	M332R	probably damaging	Het
Ptprq	G	T	10: 107,542,653	S2009*	probably null	Het
Rangrf	C	T	11: 68,973,688	G11R	probably damaging	Het
Rbl2	A	T	8: 91,096,839	Q465L	probably benign	Het
Rhbdd1	A	T	1: 82,340,659	M88L	probably benign	Het
Setd2	G	A	9: 110,532,717	M13I	probably benign	Het
Sirpb1a	T	C	3: 15,379,020	Y384C	probably damaging	Het
Slc13a1	C	T	6: 24,097,612	G439S	probably damaging	Het
Slc41a1	T	A	1: 131,841,149	I239N	probably damaging	Het
Slit2	T	A	5: 48,304,167	C1502S	probably damaging	Het
Slit3	G	A	11: 35,661,292	E888K	probably benign	Het
Srrm3	G	T	5: 135,835,234	R62L	probably damaging	Het
Synm	A	G	7: 67,735,583	V777A	possibly damaging	Het
Trmt13	T	A	3: 116,592,215	N31I	probably damaging	Het
Trpm8	G	A	1: 88,361,998	E893K	probably damaging	Het
Uqcc1	A	G	2: 155,851,423	F197S	probably damaging	Het
Vmn1r67	T	A	7: 10,447,671	N287K	probably benign	Het
Vmn2r44	A	T	7: 8,378,099	M265K	probably benign	Het
Wwc1	C	T	11: 35,853,437	E853K	probably benign	Het
Xdh	C	A	17: 73,900,551	C937F	probably damaging	Het
Zfp846	T	A	9: 20,593,871	N342K	probably benign	Het

Other mutations in Arhgef15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00929:Arhgef15	APN	11	68954102	missense	probably damaging	1.00
IGL02382:Arhgef15	APN	11	68954030	missense	probably damaging	0.98
R0041:Arhgef15	UTSW	11	68954516	missense	possibly damaging	0.92
R0208:Arhgef15	UTSW	11	68946373	missense	probably benign	0.09
R0276:Arhgef15	UTSW	11	68953472	splice site	probably benign
R0368:Arhgef15	UTSW	11	68954693	missense	probably damaging	0.99
R0706:Arhgef15	UTSW	11	68954576	missense	probably damaging	1.00
R1628:Arhgef15	UTSW	11	68944814	missense	possibly damaging	0.86
R1966:Arhgef15	UTSW	11	68954675	missense	probably damaging	1.00
R2105:Arhgef15	UTSW	11	68947681	splice site	probably null
R2278:Arhgef15	UTSW	11	68951691	missense	probably damaging	1.00
R4667:Arhgef15	UTSW	11	68954561	missense	probably benign	0.00
R4836:Arhgef15	UTSW	11	68949925	intron	probably benign
R4898:Arhgef15	UTSW	11	68951345	missense	probably benign	0.00
R4966:Arhgef15	UTSW	11	68947317	missense	probably benign	0.08
R5304:Arhgef15	UTSW	11	68947237	missense	probably null	0.32
R5333:Arhgef15	UTSW	11	68947196	intron	probably benign
R5546:Arhgef15	UTSW	11	68954051	missense	probably benign	0.01
R5632:Arhgef15	UTSW	11	68954051	missense	probably benign	0.01
R5707:Arhgef15	UTSW	11	68954715	missense	probably damaging	0.98
R5839:Arhgef15	UTSW	11	68954156	missense	probably benign	0.00
R5926:Arhgef15	UTSW	11	68951955	missense	possibly damaging	0.76
R6376:Arhgef15	UTSW	11	68954970	missense	unknown
R6429:Arhgef15	UTSW	11	68947796	missense	probably damaging	1.00
R6749:Arhgef15	UTSW	11	68954557	missense	probably damaging	0.99
R7460:Arhgef15	UTSW	11	68947035	missense	probably damaging	1.00
R7529:Arhgef15	UTSW	11	68954022	missense	probably damaging	1.00
R7598:Arhgef15	UTSW	11	68946410	missense	probably damaging	1.00
R7767:Arhgef15	UTSW	11	68953847	missense	probably damaging	0.99
R7919:Arhgef15	UTSW	11	68947605	missense	probably benign	0.00
R8488:Arhgef15	UTSW	11	68947670
X0067:Arhgef15	UTSW	11	68944830	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAGTCTGGAGTCCTTCTCTACAC -3'
(R):5'- CTCCTGAAATCATGTTAAGGCTG -3'

Sequencing Primer
(F):5'- TACACCAGTCTGTCCCCCGAG -3'
(R):5'- GCTGAGGCCGGAGCTGG -3'

Posted On

2019-02-15